View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_496 (Length: 207)
Name: NF10140A_low_496
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_496 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 2 - 207
Target Start/End: Complemental strand, 4082858 - 4082651
Alignment:
| Q |
2 |
atttaatggttttgtttcttggcaaatgatgattgaagggtgtctggggaattcaaattcctatagaaatat--atatggttttgggaaatgatcaaatg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
4082858 |
atttaatggttttgtttcttggcaaatgatgattgaagggtgtctggggaattgaaattcctatagaaatatatatatagttttgggaaatgatcaaatg |
4082759 |
T |
|
| Q |
100 |
gaaannnnnnnnnnnnnnnnnnnnnnnnnaagaaaaccgtatatggttgctcaaattttggagttgtagggaaggaaacatgtaggggaaagagagagtc |
199 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4082758 |
gaaattttgttttttggtttggtttgttgaagaaaaccgtatatggttgctcaaattttggagttgtagggaaggaaacatgtaggggaaagagagagtc |
4082659 |
T |
|
| Q |
200 |
taaacttg |
207 |
Q |
| |
|
|||||||| |
|
|
| T |
4082658 |
taaacttg |
4082651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University