View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_497 (Length: 207)
Name: NF10140A_low_497
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10140A_low_497 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 13 - 186
Target Start/End: Complemental strand, 8928127 - 8927954
Alignment:
Q |
13 |
ggctggtcaaatcagaattaaaagtgtatggagaatggtctcttgacagtgcagctataggtctggcatggttggatgatcaggtaataaatcatcatct |
112 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8928127 |
ggctggtcaaatcagaattaaaagtatatggagaatggtctcttgacagtgcagctataggtctggcatggttggatgatcaggtaataaatcatcatct |
8928028 |
T |
 |
Q |
113 |
gcctacttagattagttagacatgtggctacttttattcttcactgtttcattcccatttactcttgtatctcc |
186 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8928027 |
gcctacttagattagttagacatgtggctacttttattcttcactgtttcattcccatttactcttgtatctcc |
8927954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University