View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_500 (Length: 207)
Name: NF10140A_low_500
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_500 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 20 - 188
Target Start/End: Complemental strand, 8758199 - 8758031
Alignment:
| Q |
20 |
aaattgattgtatacatactcagaagaatggtggaacagataagaattatgagtggctgaaaaaccttaacatttacaatgatgatggcaatgtactact |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
8758199 |
aaattgattgtatacatactcagaagaatggtggaatagataagaattatgaatggctgaaaaaccttaacatttacaatgatgatggcaatgtactatt |
8758100 |
T |
 |
| Q |
120 |
cttcctactgatgcaatttatgatggaatcctcttgaacctctagactgataaagctccaacctactct |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8758099 |
cttcctactgatgcaatttatgatggaatcctcttgaacctctagactgataaagctccaacctactct |
8758031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 116 - 188
Target Start/End: Original strand, 32030362 - 32030431
Alignment:
| Q |
116 |
tactcttcctactgatgcaatttatgatggaatcctcttgaacctctagactgataaagctccaacctactct |
188 |
Q |
| |
|
||||||||||| ||||| ||||| || |||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
32030362 |
tactcttcctattgatgtaatttttg---gaatcctcttgaacctctagactggtaaagctccagcctactct |
32030431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University