View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_513 (Length: 203)
Name: NF10140A_low_513
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_513 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 14 - 193
Target Start/End: Original strand, 34531204 - 34531383
Alignment:
| Q |
14 |
aagaatatagtgtgcttatactttatggataattgagggtaaataatctggtttttcatttctttctaattgnnnnnnngacaaaagaagatccaaagca |
113 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34531204 |
aagaaaatagtgtgcttatactttatggataattgagggtaaataatctggtttttcatttctttctaattgtttttttgacaaaagaagatccaaagca |
34531303 |
T |
 |
| Q |
114 |
aactatgtagttgactttcatcaaatatttgctttgtagaaccagagagtcaattacttgctactgtagtgatgtccatc |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34531304 |
aactatgtagttgactttcatcaaatatttgctttgtagaaccagagagtcaattacttgctactgtagtgatgtccatc |
34531383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University