View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_520 (Length: 201)
Name: NF10140A_low_520
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_520 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 2e-97; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 35489834 - 35489643
Alignment:
| Q |
1 |
gtctatatgttgcggcatttgcatggtcttggggtgcgttgggatggtcagttcctagtgaaatatgctctcttgaagtccgatctgcaggtcaagctac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35489834 |
gtctatatgttgcggcatttgcatggtcttggggtgcgctgggatggttagttcccagtgaaatatgctctcttgaagtccgatctgcaggtcaagctac |
35489735 |
T |
 |
| Q |
101 |
caatgttgcagtgaacatgttgttcacctttatcattgctcaagtttttcttaccatgctttgtcacttgaagtttggacttttcttcttct |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35489734 |
caatgttgcagtgaacatgttgttcacctttatcattgctcaagtttttcttaccatgctttgtcacttgaagtttggacttttcttcttct |
35489643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 125 - 179
Target Start/End: Complemental strand, 18233891 - 18233837
Alignment:
| Q |
125 |
cacctttatcattgctcaagtttttcttaccatgctttgtcacttgaagtttgga |
179 |
Q |
| |
|
||||||||||||||||||| |||| ||| |||||||||||| ||||||||||| |
|
|
| T |
18233891 |
cacctttatcattgctcaaattttcactacaatgctttgtcacatgaagtttgga |
18233837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 96; Significance: 3e-47; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 5 - 192
Target Start/End: Original strand, 14233113 - 14233300
Alignment:
| Q |
5 |
atatgttgcggcatttgcatggtcttggggtgcgttgggatggtcagttcctagtgaaatatgctctcttgaagtccgatctgcaggtcaagctaccaat |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||| |||| ||| ||||||||||||||| |||| || || ||| | ||||||||||||| ||| |
|
|
| T |
14233113 |
atatgttgcggcatttgcatggtcttggggaccattgggttggttagtgcctagtgaaatatgcgctctagaggttcgaccagcaggtcaagctataaat |
14233212 |
T |
 |
| Q |
105 |
gttgcagtgaacatgttgttcacctttatcattgctcaagtttttcttaccatgctttgtcacttgaagtttggacttttcttcttct |
192 |
Q |
| |
|
||||| ||||||||||| ||||| ||||| ||||||||||| || || |||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
14233213 |
gttgcggtgaacatgttcttcacatttatgattgctcaagtcttcctaaccatgctttgtcacttgaagtttggccttttctttttct |
14233300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 5 - 192
Target Start/End: Original strand, 14242787 - 14242974
Alignment:
| Q |
5 |
atatgttgcggcatttgcatggtcttggggtgcgttgggatggtcagttcctagtgaaatatgctctcttgaagtccgatctgcaggtcaagctaccaat |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||| |||| ||| ||||||||| ||||| |||| || || ||| | ||||||||||||| ||| |
|
|
| T |
14242787 |
atatgttgcggcatttgcatggtcttggggaccattgggttggttagtgcctagtgaagtatgcgctctagaggttcgaccagcaggtcaagctataaat |
14242886 |
T |
 |
| Q |
105 |
gttgcagtgaacatgttgttcacctttatcattgctcaagtttttcttaccatgctttgtcacttgaagtttggacttttcttcttct |
192 |
Q |
| |
|
||||| ||||||||||| ||||| ||||| ||||||||||| || || |||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
14242887 |
gttgcggtgaacatgttcttcacatttatgattgctcaagtcttcctaaccatgctttgtcacttgaagtttggccttttctttttct |
14242974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 5 - 173
Target Start/End: Original strand, 51580547 - 51580714
Alignment:
| Q |
5 |
atatgttgcggcatttgcatggtcttggggtgcgttgggatggtcagttcctagtgaaatatgctctcttgaagtccgatctgcaggtcaagctaccaat |
104 |
Q |
| |
|
|||||||||||||||||| |||||||||| || | || ||||| | || |||||||| || |||||||| || |||||||||||||||||| |||| |
|
|
| T |
51580547 |
atatgttgcggcatttgctgggtcttggggcccgctaggttggtcgga-ccaagtgaaatttgttctcttgaggtttgatctgcaggtcaagctatcaat |
51580645 |
T |
 |
| Q |
105 |
gttgcagtgaacatgttgttcacctttatcattgctcaagtttttcttaccatgctttgtcacttgaag |
173 |
Q |
| |
|
||||| ||||||||||| ||||| ||| | ||||||||||||| || | ||||||||||||||||||| |
|
|
| T |
51580646 |
gttgccgtgaacatgttattcacatttgttgttgctcaagttttcctcaacatgctttgtcacttgaag |
51580714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University