View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_522 (Length: 201)
Name: NF10140A_low_522
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_522 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 13 - 191
Target Start/End: Original strand, 7939421 - 7939599
Alignment:
| Q |
13 |
gacatcacaaaatgcatgagtagatagcaggaagctccagtagcaggatatgcaccaagcatagtagttacatttctactaaacgtatagaagatagata |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7939421 |
gacatcacaaaatgcatgagtagatagcaggaagctccagtggcaggatatgcaccaagcatagtagttacatttctactaaacgtatagaagatagata |
7939520 |
T |
 |
| Q |
113 |
tgattataaagttaatatcacagttatgagttgttcacctgagtgaggttttgaaagtaatcacacccttatattattc |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
7939521 |
tgattataaagttaatatcacagttatgagttgttcacctgagtgaggttttgaaagtaatcacacccttattttattc |
7939599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University