View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_67 (Length: 369)
Name: NF10140A_low_67
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_67 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 8e-80; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 8e-80
Query Start/End: Original strand, 25 - 248
Target Start/End: Complemental strand, 44547176 - 44546958
Alignment:
| Q |
25 |
cccccgacattcacacaatcggtgcatcgctaactgttagatgggatcaagatctgaaccatttggtctcgatccaacggttaccgatgggctgactgga |
124 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44547176 |
cccccgacat-cacacaatcagtgcatcgctaactgttagatgggatcaagatctgaaccatttggtctcgatccaacggttaccgatgggctgactgga |
44547078 |
T |
 |
| Q |
125 |
agcaatggcattcgaatagatagtacatacacatcataaaagaaagataaaatgtggactattagnnnnnnnnnnnnttgacaaatataagattgcatat |
224 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
44547077 |
agcaatgacattcga----atagtacatacacatcataaaagaaagataaaatgtggactattagaaaaaagaaaaattgacaaatttaagattgcatat |
44546982 |
T |
 |
| Q |
225 |
taccaagctttccacattaattat |
248 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
44546981 |
taccaagctttccacattaattat |
44546958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 313 - 365
Target Start/End: Complemental strand, 44546893 - 44546841
Alignment:
| Q |
313 |
acaaatgtagctttcacagctgaaacaccttcttcctcattcacatcgttctt |
365 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44546893 |
acaaatgtagctttcacagctgaaacaccttcttcctcattcacatcgttctt |
44546841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University