View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_68 (Length: 367)
Name: NF10140A_low_68
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_68 |
 |  |
|
| [»] scaffold0434 (3 HSPs) |
 |  |  |
|
| [»] scaffold0989 (2 HSPs) |
 |  |  |
|
| [»] scaffold0029 (1 HSPs) |
 |  |  |
|
| [»] scaffold1138 (2 HSPs) |
 |  |  |
|
| [»] scaffold0054 (2 HSPs) |
 |  |  |
|
| [»] scaffold0060 (2 HSPs) |
 |  |  |
|
| [»] scaffold0459 (1 HSPs) |
 |  |  |
|
| [»] scaffold0366 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 241; Significance: 1e-133; HSPs: 121)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 48 - 354
Target Start/End: Original strand, 27177595 - 27177900
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttgatc-gagtttagatagaggaggcaatcctatcaagtgtgag |
146 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||| ||||| ||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
27177595 |
gcgtgaggggggtgtattggaaaaaactcaagtctcacatgagatagataagactcttgatcagagtttagatagaggaggcaatcttatcaagtgtgag |
27177694 |
T |
 |
| Q |
147 |
ttaactctccctgaatcaagtgaataagagtaattttcgatatattatagccattgatattgagagattctttatctgcttctaagttaaccccactata |
246 |
Q |
| |
|
||| | ||||||| |||||||||||||||||||||||||| ||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
27177695 |
ttatcactccctggatcaagtgaataagagtaattttcgacatattatagccattgatatcgagggattctttatctgcttctaagttaaccccactata |
27177794 |
T |
 |
| Q |
247 |
tgctgccattgcaccaccatcactttcatcagtagttatattcacgttcctcccatgcagaagaatgtttcttttcctaaacaagtatactgttttcttt |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
27177795 |
tgctgccattgcaccaccatcactttcatcagtagt--tattcacgttcctcccatgcagaagaatgtttgttttcctaaacaagtatactgttttcttt |
27177892 |
T |
 |
| Q |
347 |
tactatct |
354 |
Q |
| |
|
|||||||| |
|
|
| T |
27177893 |
tactatct |
27177900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 48 - 134
Target Start/End: Original strand, 50692504 - 50692591
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||| |||||| |||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
50692504 |
gcgtgaggggggtgtattgggaaaaacccaagtcccacatcggatagacaagactcttgataagagtttataaagaggaggcaatcct |
50692591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 48 - 107
Target Start/End: Complemental strand, 9264212 - 9264153
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
9264212 |
gcgtgaggggggtgtattgggaaaaacccaagtcccacatcggatagataagactcttga |
9264153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 60 - 134
Target Start/End: Original strand, 26915106 - 26915181
Alignment:
| Q |
60 |
tgtattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||||||||| ||||||| ||||||||| ||||||| |
|
|
| T |
26915106 |
tgtattggaaaaaactcaagtcccagatcagatagataagactcttgataagagtttatatagaggagacaatcct |
26915181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 48 - 134
Target Start/End: Original strand, 49477512 - 49477599
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||||||| |||| ||||||||||| ||||||||||||| |||||||||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
49477512 |
gcgtgaggggggtgtgttgggaaaaacccaagtcccacatcggatagataagactcttgagaagagtttataaagaggaggcaatcct |
49477599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 27177491 - 27177534
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27177491 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
27177534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 48 - 134
Target Start/End: Original strand, 35015463 - 35015550
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||||||||| ||||||||| ||||||||| |||||| | ||||||||||||||| |
|
|
| T |
35015463 |
gcgtgaggggggtgtattgggaaaaagccaagtcccacatcggatagataaaactcttgataaaagtttataaagaggaggcaatcct |
35015550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 62 - 134
Target Start/End: Original strand, 40926446 - 40926519
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||||||||| || |||||||||| ||||||||||||||||||| ||||||| ||||||||| ||||||| |
|
|
| T |
40926446 |
tattgggaaaaacacatgtcccacatcggatagataagactcttgataagagtttatatagaggagacaatcct |
40926519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 62 - 107
Target Start/End: Complemental strand, 51338553 - 51338508
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
51338553 |
tattgggaaaaacccaagtcccacatcagatagataagactcttga |
51338508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 62 - 107
Target Start/End: Complemental strand, 53640284 - 53640239
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
53640284 |
tattgggaaaaacccaagtcccacatcagatagataagactcttga |
53640239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 59 - 107
Target Start/End: Complemental strand, 10758883 - 10758835
Alignment:
| Q |
59 |
gtgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10758883 |
gtgtattggaaaaaactcaagtcccacatcggatagataagactcttga |
10758835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 60 - 108
Target Start/End: Original strand, 29369791 - 29369839
Alignment:
| Q |
60 |
tgtattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
29369791 |
tgtattgggaaaaacccaagtcccacatcggatagataagactcttgat |
29369839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 61 - 132
Target Start/End: Complemental strand, 50338495 - 50338423
Alignment:
| Q |
61 |
gtattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatc |
132 |
Q |
| |
|
|||||| |||||||||||||| || ||||||||||||||||||||||| ||||||| ||||||||| ||||| |
|
|
| T |
50338495 |
gtattgagaaaaactcaagtctcatatcagatagataagactcttgataagagtttatatagaggagacaatc |
50338423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 4255998 - 4256041
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4255998 |
ggttttgtaaggatgagttaggccccaaatttcaacatggtatc |
4256041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 9264318 - 9264275
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9264318 |
ggttttgtaaggatgagttaggccccaaatttcaacatggtatc |
9264275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 48 - 107
Target Start/End: Complemental strand, 9264419 - 9264360
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||||||||| |||||| ||||||||||| |
|
|
| T |
9264419 |
gcgtgaggggggtgtattgggaaaaatccaagtcccacatcggatagacaagactcttga |
9264360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 22407673 - 22407630
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
22407673 |
ggttttgtaaggatgagttaggccccaaatttcaacatggtatc |
22407630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 35011736 - 35011779
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
35011736 |
ggttttgtaaggatgagttaggccccaaatttcaacatggtatc |
35011779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 48 - 134
Target Start/End: Original strand, 35011842 - 35011929
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||||||| ||||||||||||||||| ||||||| | |||||||||| |||| |
|
|
| T |
35011842 |
gcgtgaggggggtgtattgggaaaaacccaagtcccacattgagtagataagactcttgataagagtttataaagaggaggcactcct |
35011929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 44573718 - 44573761
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
44573718 |
ggttttgtaaggatgagttaggccccaaatttcaacatggtatc |
44573761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 51642660 - 51642617
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
51642660 |
ggttttgtaaggatgagttaggccccaaatttcaacatggtatc |
51642617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 61 - 134
Target Start/End: Original strand, 26926899 - 26926972
Alignment:
| Q |
61 |
gtattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||| |||||| || |||||||||||||||||||||||||||||| ||||||| ||||||||| ||||||| |
|
|
| T |
26926899 |
gtattggaaaaaac-catgtcccacatcagatagataagactcttgataagagtttatatagaggagacaatcct |
26926972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 69 - 134
Target Start/End: Original strand, 34992576 - 34992642
Alignment:
| Q |
69 |
aaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
34992576 |
aaaaacccaagtcccacatcagatagataagactcttgagaagagtttataaagaggaggcaatcct |
34992642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 69 - 134
Target Start/End: Original strand, 34992868 - 34992934
Alignment:
| Q |
69 |
aaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
34992868 |
aaaaacccaagtcccacatcagatagataagactcttgagaagagtttataaagaggaggcaatcct |
34992934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 61 - 107
Target Start/End: Complemental strand, 37058884 - 37058838
Alignment:
| Q |
61 |
gtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
37058884 |
gtattgggaaaaacccaagtcccacatcagatagacaagactcttga |
37058838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 69 - 134
Target Start/End: Complemental strand, 39956779 - 39956713
Alignment:
| Q |
69 |
aaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
39956779 |
aaaaactcaagtcccacatcagatagacaagactcttgagaagagtttataaagaggaggcaatcct |
39956713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 58 - 108
Target Start/End: Complemental strand, 44145236 - 44145187
Alignment:
| Q |
58 |
agtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44145236 |
agtgtattggggaaaactca-gtcccacatcagatagataagactcttgat |
44145187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 2 - 44
Target Start/End: Original strand, 50057109 - 50057151
Alignment:
| Q |
2 |
gttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
50057109 |
gttttgtaaggatgagttaggccccaaatttcaacatggtatc |
50057151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 62 - 107
Target Start/End: Complemental strand, 9264612 - 9264567
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
9264612 |
tattgggaaaaacccaagtcccacatcggatagataagactcttga |
9264567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 59 - 108
Target Start/End: Original strand, 26927101 - 26927150
Alignment:
| Q |
59 |
gtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
26927101 |
gtgtattgggaaaaactcttgtcccacatcatatagataagactcttgat |
26927150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 62 - 134
Target Start/End: Complemental strand, 39018902 - 39018829
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||||||| ||||||| ||||||||| ||||||| |
|
|
| T |
39018902 |
tattgggaaaaacttttgtcccacatcggatagataagactcttgataggagtttatatagaggagacaatcct |
39018829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 48 - 105
Target Start/End: Complemental strand, 39956593 - 39956536
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactctt |
105 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||||||||||||| |||| |||| |
|
|
| T |
39956593 |
gcgtgaggggggtgtattgggaaaaatccaagtcccacatcagatagacaagaatctt |
39956536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 3 - 44
Target Start/End: Original strand, 50057240 - 50057281
Alignment:
| Q |
3 |
ttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
50057240 |
ttttgtaaggatgagttaggccccaaatttcaacatggtatc |
50057281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 3 - 44
Target Start/End: Original strand, 50057370 - 50057411
Alignment:
| Q |
3 |
ttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
50057370 |
ttttgtaaggatgagttaggccccaaatttcaacatggtatc |
50057411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 62 - 134
Target Start/End: Original strand, 50692315 - 50692388
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||| ||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
50692315 |
tattgggaaaaacccaagtcccacatcggatagacaagactcttgagaagagtttataaagaggaggcaatcct |
50692388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 48 - 108
Target Start/End: Complemental strand, 40230560 - 40230500
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
|||| ||||| |||||||||||||||| ||||| ||||||| ||||||| ||||||||||| |
|
|
| T |
40230560 |
gcgttaggggggtgtattgggaaaaacccaagttccacatcggatagatgagactcttgat |
40230500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 47833678 - 47833642
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47833678 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
47833642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 4191147 - 4191104
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
4191147 |
ggttttgtaaggatgagttaggccccaaatttcaatatggtatc |
4191104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 4255589 - 4255632
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4255589 |
ggttttgcaaggatgagttaggccccaaatttcaacatggtatc |
4255632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 4255816 - 4255859
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
4255816 |
ggttttgtaaggatgagttaggacccaaatttcaacatggtatc |
4255859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 9264525 - 9264482
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
9264525 |
ggttttgtaaggatgagttaggccccaaattacaacatggtatc |
9264482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 69 - 108
Target Start/End: Original strand, 12800089 - 12800128
Alignment:
| Q |
69 |
aaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
12800089 |
aaaaactcaagtcccacgtcagatagataagactcttgat |
12800128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 19820553 - 19820510
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
19820553 |
ggttttgtaaggatgagttaggcctcaaatttcaacatggtatc |
19820510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 20737099 - 20737142
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
20737099 |
ggtttagtaagcatgatttaggccccaaatttcaacatggtatc |
20737142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 21832716 - 21832673
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
21832716 |
ggttttgtaaggatgagttaggccccaaatttcaatatggtatc |
21832673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 33909655 - 33909612
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
33909655 |
ggttttgtaaggatgagttagaccccaaatttcaacatggtatc |
33909612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 60 - 107
Target Start/End: Complemental strand, 35358567 - 35358520
Alignment:
| Q |
60 |
tgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
35358567 |
tgtattgggaaaaatccaagtctcacatcagatagataagactcttga |
35358520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 37058796 - 37058753
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
37058796 |
ggttttgtaaggatgagttaggcccaaaatttcaacatggtatc |
37058753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 39078796 - 39078753
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
39078796 |
ggttttgtaaggatgagttaggccccaaattacaacatggtatc |
39078753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 39956699 - 39956656
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
39956699 |
ggttttgtaaggatgagttaggctccaaatttcaacatggtatc |
39956656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 60 - 134
Target Start/End: Original strand, 40927020 - 40927095
Alignment:
| Q |
60 |
tgtattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||| |||||||| || |||||||||| ||||||||||||||||||| ||||||| ||||||||| ||||||| |
|
|
| T |
40927020 |
tgtatcgggaaaaatccatgtcccacatcggatagataagactcttgataagagtttatatagaggagacaatcct |
40927095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 48 - 107
Target Start/End: Original strand, 42258888 - 42258947
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||| ||| ||||||||||||||| ||||||||||||| ||||||||||| |||||| |
|
|
| T |
42258888 |
gcgtgatgggggtgtattgggaaaaatccaagtcccacatcggatagataagattcttga |
42258947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 50692402 - 50692441
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatgg |
40 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
50692402 |
ggttttgtaaggatgagttaggccccaaatttcaacatgg |
50692441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 48 - 107
Target Start/End: Complemental strand, 51642554 - 51642495
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||||||| |||||||| ||||||| |||||||||| | |||||||||||||||||| |
|
|
| T |
51642554 |
gcgtgaggggggtgtattgcgaaaaacccaagtcccacgttggatagataagactcttga |
51642495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 48 - 107
Target Start/End: Complemental strand, 54591591 - 54591532
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
||||||| || ||||||||||||||| ||||||||||||| |||||| ||||||||||| |
|
|
| T |
54591591 |
gcgtgagaggggtgtattgggaaaaatccaagtcccacatcggatagacaagactcttga |
54591532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 61 - 107
Target Start/End: Complemental strand, 4191235 - 4191189
Alignment:
| Q |
61 |
gtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||| ||||||||||| |
|
|
| T |
4191235 |
gtattgggaaaaacccaagtcccacatcggatagacaagactcttga |
4191189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 50 - 100
Target Start/End: Complemental strand, 19984525 - 19984475
Alignment:
| Q |
50 |
gtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataaga |
100 |
Q |
| |
|
|||| ||| ||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
19984525 |
gtgacgggggtgtattgggaaaaactcatgtcccacatcggatagataaga |
19984475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 62 - 108
Target Start/End: Original strand, 32034083 - 32034129
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
32034083 |
tattgggaaaaactcatgtcccacatcgaatagataagactcttgat |
32034129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 9264111 - 9264074
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacat |
38 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9264111 |
ggttttgtaaggatgagttaggccccaaatttcaacat |
9264074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 62 - 134
Target Start/End: Original strand, 22339733 - 22339806
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||| ||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
22339733 |
tattgggaaaaatccaagtcccacatcggatagacaagactcttgagaagagtttataaagaggaggcaatcct |
22339806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 60 - 132
Target Start/End: Complemental strand, 25578794 - 25578722
Alignment:
| Q |
60 |
tgtattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatc |
132 |
Q |
| |
|
||||||||||||||| || |||||||||| ||||||||||||| ||||| ||||||| ||||||||| ||||| |
|
|
| T |
25578794 |
tgtattgggaaaaacccatgtcccacatcggatagataagact-ttgataagagtttatatagaggagacaatc |
25578722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 70 - 126
Target Start/End: Complemental strand, 32516011 - 32515954
Alignment:
| Q |
70 |
aaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggag |
126 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
32516011 |
aaaactcatgtcccacatcggatagataagactcttgataggagtttatatagaggag |
32515954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 62 - 134
Target Start/End: Complemental strand, 39078883 - 39078810
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||||||||| ||||||||| ||| |||||| ||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
39078883 |
tattgggaaaaacccaagtcccatatcggatagacaagactcttgagaagagtttataaagaggaggcaatcct |
39078810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 62 - 134
Target Start/End: Complemental strand, 40230751 - 40230678
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||| ||||||| ||||| ||||||| ||||||| ||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
40230751 |
tattgagaaaaacccaagttccacatcggatagatgagactcttgatgagagtttataaagaggaggcaatcct |
40230678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 67 - 134
Target Start/End: Original strand, 40926699 - 40926768
Alignment:
| Q |
67 |
ggaaaaactcaa-gtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||| |||| |||||||||| ||||||||||||||||||| ||||||| ||||||||| ||||||| |
|
|
| T |
40926699 |
ggaaaaaatcaatgtcccacatcggatagataagactcttgataagagtttatatagaggagacaatcct |
40926768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 62 - 107
Target Start/End: Complemental strand, 47702536 - 47702491
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||| |||||||||| |
|
|
| T |
47702536 |
tattgggaaaaacacaagtcccacatcggatagatgagactcttga |
47702491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 48685337 - 48685300
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacat |
38 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
48685337 |
ggttttgtaaggatgagttaggccccaaatttcaacat |
48685300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 62 - 107
Target Start/End: Original strand, 54495523 - 54495568
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
54495523 |
tattgggaaaaatccaagtcccacatcggatagataagactcttga |
54495568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 4029669 - 4029633
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4029669 |
ggttttgtaaggatgagttaggccccaaatttcaaca |
4029633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 21832224 - 21832188
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
21832224 |
ggttttgtaaggatgagttaggccccaaatttcaaca |
21832188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 22407466 - 22407430
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
22407466 |
ggttttgtaaggatgagttaggccccaaatttcaaca |
22407430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 35011943 - 35011979
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35011943 |
ggttttgtaaggatgagttaggccccaaatttcaaca |
35011979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 79 - 134
Target Start/End: Original strand, 39269509 - 39269565
Alignment:
| Q |
79 |
gtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| ||||||||| ||||||| |
|
|
| T |
39269509 |
gtcccacatcggatagataagactcttgataagagtttatatagaggagacaatcct |
39269565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 79 - 134
Target Start/End: Original strand, 40926790 - 40926846
Alignment:
| Q |
79 |
gtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||||||| ||||||||| ||||||| |
|
|
| T |
40926790 |
gtcccatatcagatagataagactcttgataagagtttatatagaggagacaatcct |
40926846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 59 - 134
Target Start/End: Original strand, 44367767 - 44367843
Alignment:
| Q |
59 |
gtgtattgggaaaaactcaagtcccacatcagatagataagactcttgatc-gagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||||||| ||||||| ||||| | || ||||||||| ||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
44367767 |
gtgtattgggtaaaactcttgtccctcgtcggatagataaaactcttgataagagtttatatagaggaggcaatcct |
44367843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 44574015 - 44574051
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44574015 |
ggttttgtaaggatgagttaggccccaaatttcaaca |
44574051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 50203882 - 50203846
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
50203882 |
ggttttgtaaggatgagttaggccccaaatttcaaca |
50203846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 50692605 - 50692641
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
50692605 |
ggttttgtaaggatgagttaggccccaaatttcaaca |
50692641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 51338428 - 51338392
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
51338428 |
ggttttgtaaggatgagttaggccccaaatttcaaca |
51338392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 51642453 - 51642417
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
51642453 |
ggttttgtaaggatgagttaggccccaaatttcaaca |
51642417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 60 - 107
Target Start/End: Original strand, 5440567 - 5440614
Alignment:
| Q |
60 |
tgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
||||||||||||||| ||||| ||||||| |||||| ||||||||||| |
|
|
| T |
5440567 |
tgtattgggaaaaacccaagttccacatcggatagacaagactcttga |
5440614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 10759033 - 10758990
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||| |||| |
|
|
| T |
10759033 |
ggttttgtaaggatgagttagaccccaaatttcaacatgatatc |
10758990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 2 - 37
Target Start/End: Original strand, 21750555 - 21750590
Alignment:
| Q |
2 |
gttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |
|
|
| T |
21750555 |
gttttgtaaggatgagttaggccccaaatttcaaca |
21750590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 60 - 107
Target Start/End: Complemental strand, 21832805 - 21832758
Alignment:
| Q |
60 |
tgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||||| |||| ||||||||||||||| |||||| ||||||||||| |
|
|
| T |
21832805 |
tgtattggaaaaatctcaagtcccacatcggatagacaagactcttga |
21832758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 62 - 105
Target Start/End: Complemental strand, 25628033 - 25627990
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactctt |
105 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||| |||| |
|
|
| T |
25628033 |
tattgggaaaaacccaagtcccacatcggatagataagattctt |
25627990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 33909858 - 33909815
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggc-cccaaatttcaacatggtat |
43 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
33909858 |
ggttttgtaaggatgagttaggctcccaaatttcaacatggtat |
33909815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 62 - 132
Target Start/End: Original strand, 37223567 - 37223638
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatc |
132 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||||| ||| ||||||| | ||||||||||||| |
|
|
| T |
37223567 |
tattgggaaaaacctaagtcccacatcggatagataagactcctgagaagagtttataaagaggaggcaatc |
37223638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 37223654 - 37223697
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
||||||||||||| || |||||| |||||||||||||||||||| |
|
|
| T |
37223654 |
ggttttgtaaggaagagttaggctccaaatttcaacatggtatc |
37223697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 38300777 - 38300734
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
||||||||| |||||| ||||||| ||||||||||||||||||| |
|
|
| T |
38300777 |
ggttttgtacggatgagttaggcctcaaatttcaacatggtatc |
38300734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 2 - 37
Target Start/End: Complemental strand, 39956491 - 39956456
Alignment:
| Q |
2 |
gttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |
|
|
| T |
39956491 |
gttttgtaaggatgaattaggccccaaatttcaaca |
39956456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 40230664 - 40230621
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||| ||| ||| ||||||||||||||||||||||| |
|
|
| T |
40230664 |
ggttttgtaaggttgagttaagccccaaatttcaacatggtatc |
40230621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 60 - 134
Target Start/End: Original strand, 44367569 - 44367644
Alignment:
| Q |
60 |
tgtattgggaaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||||||||||| | ||| || |||||||||||||||||||||| ||||||| ||||||||| ||||||| |
|
|
| T |
44367569 |
tgtattgggaaaaaccgatgtctcatatcagatagataagactcttgagaagagtttatatagaggagacaatcct |
44367644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 44573405 - 44573448
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| |||||||| | |||||||||||||||| |
|
|
| T |
44573405 |
ggttttgtaaggatgagttaggccctagatttcaacatggtatc |
44573448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 60 - 107
Target Start/End: Complemental strand, 53640079 - 53640032
Alignment:
| Q |
60 |
tgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||||||||||| ||||||||| ||| |||||||||||||||||| |
|
|
| T |
53640079 |
tgtattgggaaaaatccaagtcccatatcggatagataagactcttga |
53640032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 2 - 44
Target Start/End: Original strand, 12799757 - 12799799
Alignment:
| Q |
2 |
gttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
||||||||||||||| | | ||||||||||||||||||||||| |
|
|
| T |
12799757 |
gttttgtaaggatgagtgaagccccaaatttcaacatggtatc |
12799799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 59 - 105
Target Start/End: Original strand, 27177401 - 27177447
Alignment:
| Q |
59 |
gtgtattgggaaaaactcaagtcccacatcagatagataagactctt |
105 |
Q |
| |
|
||||||||| |||||||||| || |||||||||||||| |||||||| |
|
|
| T |
27177401 |
gtgtattggaaaaaactcaaatctcacatcagatagatgagactctt |
27177447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 62 - 108
Target Start/End: Complemental strand, 42637859 - 42637813
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
42637859 |
tattgggaaaaactcatatcccacattggatagataagactcttgat |
42637813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 62 - 108
Target Start/End: Complemental strand, 44145506 - 44145460
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
||||||||||||| ||| ||||||||| |||||||| |||||||||| |
|
|
| T |
44145506 |
tattgggaaaaacccaaatcccacatcggatagatatgactcttgat |
44145460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 62 - 107
Target Start/End: Complemental strand, 51642748 - 51642702
Alignment:
| Q |
62 |
tattgggaaaaactcaa-gtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
||||||||||||| ||| |||||||||| |||||||||||||||||| |
|
|
| T |
51642748 |
tattgggaaaaacccaaagtcccacatcggatagataagactcttga |
51642702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 65 - 134
Target Start/End: Complemental strand, 53761507 - 53761437
Alignment:
| Q |
65 |
tgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||||||| |||||||||| || |||||||||||| |||||| ||||||| | |||||||||| |||| |
|
|
| T |
53761507 |
tgggaaaaacccaagtcccacttcggatagataagacccttgataagagtttataaagaggaggcactcct |
53761437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 62 - 107
Target Start/End: Complemental strand, 4029756 - 4029711
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
||||||||| || ||||||||||||| |||||||||||||||||| |
|
|
| T |
4029756 |
tattgggaataatgcaagtcccacatcggatagataagactcttga |
4029711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 14170024 - 14169979
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatcta |
46 |
Q |
| |
|
|||||||||||||||| ||| |||||| ||||||||||||||||| |
|
|
| T |
14170024 |
ggttttgtaaggatgagttatcccccaattttcaacatggtatcta |
14169979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 48 - 105
Target Start/End: Original strand, 32034274 - 32034331
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactctt |
105 |
Q |
| |
|
|||||| ||| ||||||| |||||||| | |||||||||| |||||||||||||||| |
|
|
| T |
32034274 |
gcgtgacgggggtgtattaggaaaaacctatgtcccacatcggatagataagactctt |
32034331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 67 - 108
Target Start/End: Complemental strand, 37541966 - 37541925
Alignment:
| Q |
67 |
ggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
||||||| |||||||||||||| ||||||||| ||||||||| |
|
|
| T |
37541966 |
ggaaaaattcaagtcccacatcggatagataaaactcttgat |
37541925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 64 - 108
Target Start/End: Complemental strand, 1715194 - 1715150
Alignment:
| Q |
64 |
ttgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
||||||||||| ||||| ||||||||| |||||||||||||||| |
|
|
| T |
1715194 |
ttgggaaaaaccgaagtctcacatcagacagataagactcttgat |
1715150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 59 - 91
Target Start/End: Original strand, 1715542 - 1715574
Alignment:
| Q |
59 |
gtgtattgggaaaaactcaagtcccacatcaga |
91 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
1715542 |
gtgtattgtgaaaaactcaagtcccacatcaga |
1715574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 3985852 - 3985888
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
3985852 |
ggttttgtaaggatgagttaggccccaaacttcaaca |
3985888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 11414442 - 11414478
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
11414442 |
ggttttgtaaggatgagttaggcctcaaatttcaaca |
11414478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 21833603 - 21833639
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
21833603 |
ggtttcgtaaggatgagttaggccccaaatttcaaca |
21833639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 22339820 - 22339856
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
22339820 |
ggttttgtaaggatgagttaggcccccaatttcaaca |
22339856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 3 - 39
Target Start/End: Original strand, 24539235 - 24539271
Alignment:
| Q |
3 |
ttttgtaaggatgatttaggccccaaatttcaacatg |
39 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
24539235 |
ttttgtaaggatgagttaggccccaaacttcaacatg |
24539271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 25627945 - 25627909
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
25627945 |
ggttttgtaaggatgagttaggccccaaattccaaca |
25627909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 34715480 - 34715444
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
34715480 |
ggttttgtaaggatgagttatgccccaaatttcaaca |
34715444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 38300308 - 38300272
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
38300308 |
ggttttgtaaggatgagttaggtcccaaatttcaaca |
38300272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 62 - 102
Target Start/End: Original strand, 38421977 - 38422017
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagact |
102 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
38421977 |
tattgggaaaaacctaagtcccacatcggatagataagact |
38422017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 39078706 - 39078670
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
39078706 |
ggttttgtaaggatgagttaggccccaaattacaaca |
39078670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 40230460 - 40230424
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
40230460 |
ggttttgtaaggttgagttaggccccaaatttcaaca |
40230424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 41380802 - 41380838
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
41380802 |
ggttttgtaaggttgagttaggccccaaatttcaaca |
41380838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 43101396 - 43101360
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||| |
|
|
| T |
43101396 |
ggttttgtaaggatgagtttggccccaaatttcaaca |
43101360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 45443359 - 45443395
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
45443359 |
ggttttttaaggatgagttaggccccaaatttcaaca |
45443395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 48407564 - 48407608
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggcccc-aaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| ||| ||||| |||||||||||||||||| |
|
|
| T |
48407564 |
ggttttgtaaggatgagttatgccccaaaatttcaacatggtatc |
48407608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 56; Significance: 4e-23; HSPs: 76)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 48 - 134
Target Start/End: Original strand, 32667161 - 32667248
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||| ||| |||||||||||||||| |||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
32667161 |
gcgtgacgggggtgtattgggaaaaaccgaagtcccacatcagatagataagactcttgataagagtttatatagaggaggcaatcct |
32667248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 48 - 134
Target Start/End: Complemental strand, 883727 - 883640
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||| |||||||||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
883727 |
gcgtgaggggggtgtattgggaaaaacccaagtcccacatcggatagataagactcttgagaagagtttataaagaggaggcaatcct |
883640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 48 - 107
Target Start/End: Original strand, 17727382 - 17727441
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
17727382 |
gcgtgaggggggtgtattgggaaaaacccaagtcccacatcggatagataagactcttga |
17727441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 48 - 133
Target Start/End: Original strand, 19860015 - 19860101
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcc |
133 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||| |||||| ||||||||||| ||||||| | |||||||||||||| |
|
|
| T |
19860015 |
gcgtgaggggggtgtattgggaaaaacccaagtcccacatcggatagacaagactcttgagaagagtttataaagaggaggcaatcc |
19860101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 62 - 134
Target Start/End: Original strand, 39386662 - 39386735
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||||||||| || |||||||||| ||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
39386662 |
tattgggaaaaacccatgtcccacatcggatagataagactcttgataagagtttatatagaggaggcaatcct |
39386735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 48 - 107
Target Start/End: Original strand, 884035 - 884094
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||| ||||||| |||||||||| |
|
|
| T |
884035 |
gcgtgaggggggtgtattgggaaaaacccaagtcccacatcggatagatgagactcttga |
884094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 60 - 107
Target Start/End: Original strand, 10570925 - 10570972
Alignment:
| Q |
60 |
tgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
10570925 |
tgtattgggaaaaacccaagtcccacatcagatagataagactcttga |
10570972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 48 - 107
Target Start/End: Original strand, 40009952 - 40010011
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||| ||||||||| |||||||| |
|
|
| T |
40009952 |
gcgtgaggggggtgtattgggaaaaacccaagtcccacatcggatagataaaactcttga |
40010011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 50 - 108
Target Start/End: Complemental strand, 8044669 - 8044612
Alignment:
| Q |
50 |
gtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
8044669 |
gtgagggg-gtgtattgggaaaaacccaagtcccgcatcagatagataagactcttgat |
8044612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 21214226 - 21214183
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
21214226 |
ggttttgtaaggatgagttaggccccaaatttcaacatggtatc |
21214183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 48 - 107
Target Start/End: Complemental strand, 29695464 - 29695406
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||| |||||| |||||||||||||||||| |
|
|
| T |
29695464 |
gcgtgagggg-gtgtattgggaaaaacccaagtctcacatcggatagataagactcttga |
29695406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 62 - 132
Target Start/End: Original strand, 39108080 - 39108151
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatc |
132 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||| ||||||| ||||||| |||||||||| |||| |
|
|
| T |
39108080 |
tattgggaaaaattcaagtcccacatcagatatataagaatcttgataagagtttatatagaggaggtaatc |
39108151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 62 - 134
Target Start/End: Complemental strand, 3435598 - 3435525
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||| ||||| |||||||||||||| |||||||||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
3435598 |
tattggaaaaaattcaagtcccacatcggatagataagactcttgagaagagtttatacagaggaggcaatcct |
3435525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 62 - 134
Target Start/End: Complemental strand, 6986528 - 6986455
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
6986528 |
tattgggaaaaatccaagtcccacatcggatagataagactcttgagaagagtttataaagaggaggcaatcct |
6986455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 62 - 107
Target Start/End: Original strand, 12419830 - 12419875
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
12419830 |
tattgggaaaaacccaagtcccacatcggatagataagactcttga |
12419875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 62 - 107
Target Start/End: Original strand, 12431890 - 12431935
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
12431890 |
tattgggaaaaacccaagtcccacatcggatagataagactcttga |
12431935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 62 - 134
Target Start/End: Complemental strand, 20999101 - 20999028
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||| ||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
20999101 |
tattgggaaaaacccaagtcccacatcggatagacaagactcttgagaagagtttataaagaggaggcaatcct |
20999028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 62 - 133
Target Start/End: Original strand, 19859917 - 19859989
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcc |
133 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||| ||||||||||| ||||||| | |||||||||||||| |
|
|
| T |
19859917 |
tattgggaaaaacccaagtcccacatcggatagacaagactcttgagaagagtttataaagaggaggcaatcc |
19859989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 4 - 44
Target Start/End: Original strand, 29923380 - 29923420
Alignment:
| Q |
4 |
tttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
29923380 |
tttgtaaggatgagttaggccccaaatttcaacatggtatc |
29923420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 31761211 - 31761251
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggt |
41 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31761211 |
ggttttgtaaggatgagttaggccccaaatttcaacatggt |
31761251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 59 - 107
Target Start/End: Complemental strand, 33985884 - 33985836
Alignment:
| Q |
59 |
gtgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
||||||||| |||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
33985884 |
gtgtattggcaaaaacccaagtcccacatcggatagataagactcttga |
33985836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 3435511 - 3435468
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
3435511 |
ggttttgtaaggatgagttaggccccaaattacaacatggtatc |
3435468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 3976496 - 3976453
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
3976496 |
ggttttgtaaggatgagttaggccccaaattacaacatggtatc |
3976453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 3977028 - 3976985
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
3977028 |
ggttttgtaaggatgagttaggccccaaattacaacatggtatc |
3976985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 12431977 - 12432020
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
12431977 |
ggttttgtaaggatgagctaggccccaaatttcaacatggtatc |
12432020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 48 - 134
Target Start/End: Original strand, 12432083 - 12432170
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||| || ||||||||| ||||| ||||||||||||| ||||||||||| |||||| ||||||| | ||||||||||||||| |
|
|
| T |
12432083 |
gcgtgagcggggtgtattggaaaaaatccaagtcccacatcggatagataagaatcttgagaagagtttataaagaggaggcaatcct |
12432170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 60 - 134
Target Start/End: Original strand, 29676284 - 29676359
Alignment:
| Q |
60 |
tgtattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||||||||||| || ||| |||||| ||||||||||||||||||| ||||||| ||| ||||| ||||||| |
|
|
| T |
29676284 |
tgtattgggaaaaacacatgtctcacatcggatagataagactcttgataagagtttatatataggagtcaatcct |
29676359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 60 - 107
Target Start/End: Original strand, 29684001 - 29684048
Alignment:
| Q |
60 |
tgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||| ||||||||||| |
|
|
| T |
29684001 |
tgtattgggaaaaacccaagtcccgcatcagatagacaagactcttga |
29684048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 60 - 107
Target Start/End: Original strand, 34775347 - 34775394
Alignment:
| Q |
60 |
tgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||| ||||||||||| |
|
|
| T |
34775347 |
tgtattgggaaaaacccaagtcccacatcggatagacaagactcttga |
34775394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 67 - 132
Target Start/End: Complemental strand, 4721911 - 4721845
Alignment:
| Q |
67 |
ggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatc |
132 |
Q |
| |
|
|||||||| || |||||||||| ||||||| ||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
4721911 |
ggaaaaacccatgtcccacatcggatagattagactcttgataagagtttatatagaggaggcaatc |
4721845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 62 - 108
Target Start/End: Complemental strand, 14127299 - 14127253
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
14127299 |
tattgggaaaaaccgaagtcccacatcagataaataagactcttgat |
14127253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 61 - 107
Target Start/End: Original strand, 16006968 - 16007014
Alignment:
| Q |
61 |
gtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||| ||||||||||| |
|
|
| T |
16006968 |
gtattgggaaaaacccaagtcccacatcggatagacaagactcttga |
16007014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 61 - 134
Target Start/End: Original strand, 31761123 - 31761197
Alignment:
| Q |
61 |
gtattgggaaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||||| |||| ||||||| ||||| ||||||||||| |
|
|
| T |
31761123 |
gtattgggaaaaacctaagtcccacatcggatagataagacttttgagaagagtttatatagaagaggcaatcct |
31761197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 62 - 131
Target Start/End: Original strand, 32666969 - 32667039
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaat |
131 |
Q |
| |
|
||||||||||||| |||||||| ||| |||| |||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
32666969 |
tattgggaaaaacccaagtccctcattggataaataagactcttgataagagtttatatagaggaggcaat |
32667039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 59 - 108
Target Start/End: Original strand, 10485167 - 10485216
Alignment:
| Q |
59 |
gtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
||||||||||||||| || |||||||||| ||||||||||||||||||| |
|
|
| T |
10485167 |
gtgtattgggaaaaatccatgtcccacatcggatagataagactcttgat |
10485216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 3 - 44
Target Start/End: Original strand, 25082700 - 25082741
Alignment:
| Q |
3 |
ttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
25082700 |
ttttctaaggatgaattaggccccaaatttcaacatggtatc |
25082741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 62 - 107
Target Start/End: Complemental strand, 25621397 - 25621352
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
||||||||||||| |||||| |||||| |||||||||||||||||| |
|
|
| T |
25621397 |
tattgggaaaaacccaagtctcacatcggatagataagactcttga |
25621352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 62 - 107
Target Start/End: Complemental strand, 33986087 - 33986042
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
||||||||||||| ||| ||||||||| |||||||||||||||||| |
|
|
| T |
33986087 |
tattgggaaaaacccaactcccacatcggatagataagactcttga |
33986042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 3 - 44
Target Start/End: Complemental strand, 37812536 - 37812495
Alignment:
| Q |
3 |
ttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
37812536 |
ttttgtaaggatgagttaggccccaaattacaacatggtatc |
37812495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 7257163 - 7257119
Alignment:
| Q |
1 |
ggttttgtaaggatga-tttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
7257163 |
ggttttgtaaggatgagtttaggcccccaatttcaacatggtatc |
7257119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 7257633 - 7257589
Alignment:
| Q |
1 |
ggttttgtaaggatga-tttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
7257633 |
ggttttgtaaggatgagtttaggcccccaatttcaacatggtatc |
7257589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 23054405 - 23054441
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
23054405 |
ggttttgtaaggatgagttaggccccaaatttcaaca |
23054441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 59 - 134
Target Start/End: Complemental strand, 27545231 - 27545155
Alignment:
| Q |
59 |
gtgtattgggaaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||||| ||||| || |||||||||| |||||||||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
27545231 |
gtgtattggaaaaaatccatgtcccacatcggatagataagactcttgagaagagtttataaagaggaggcaatcct |
27545155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 32667262 - 32667298
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32667262 |
ggttttgtaaggatgagttaggccccaaatttcaaca |
32667298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 33985796 - 33985760
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33985796 |
ggttttgtaaggatgagttaggccccaaatttcaaca |
33985760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 42768359 - 42768323
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42768359 |
ggttttgtaaggatgagttaggccccaaatttcaaca |
42768323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 43195863 - 43195899
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43195863 |
ggttttgtaaggatgagttaggccccaaatttcaaca |
43195899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 93487 - 93444
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||| ||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
93487 |
ggttttgtgaggatgagttatgccccaaatttcaacatggtatc |
93444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 93760 - 93717
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||| ||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
93760 |
ggttttgtgaggatgagttaggcctcaaatttcaacatggtatc |
93717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 883929 - 883972
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||| ||||||||||| |
|
|
| T |
883929 |
ggttttgtaaggatgagttaggcccccaattttaacatggtatc |
883972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 48 - 134
Target Start/End: Complemental strand, 17265100 - 17265014
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||| ||| | |||||||||||| | || |||||||||| ||||||||||||||||| | |||||| ||||||||||||||||| |
|
|
| T |
17265100 |
gcgtgacgggggcgtattgggaaaacc-catgtcccacatcggatagataagactcttggtaaaagtttatatagaggaggcaatcct |
17265014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 29101830 - 29101873
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||| ||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
29101830 |
ggttttataaggatgagttaggcctcaaatttcaacatggtatc |
29101873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 2 - 40
Target Start/End: Complemental strand, 3976809 - 3976771
Alignment:
| Q |
2 |
gttttgtaaggatgatttaggccccaaatttcaacatgg |
40 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
3976809 |
gttttgtaaggatgagttaggccccaaattacaacatgg |
3976771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 62 - 96
Target Start/End: Complemental strand, 10542175 - 10542141
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagat |
96 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |
|
|
| T |
10542175 |
tattgggaaaaactcaagtcccacattagatagat |
10542141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 22447179 - 22447217
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatg |
39 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
22447179 |
ggttttgtaaggatgagttagaccccaaatttcaacatg |
22447217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 77 - 134
Target Start/End: Original strand, 31761338 - 31761396
Alignment:
| Q |
77 |
aagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||||||||| | |||||||||||||| || ||||||| ||||||||||||||||| |
|
|
| T |
31761338 |
aagtcccacatcgggtagataagactcttaataagagtttatatagaggaggcaatcct |
31761396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 59 - 108
Target Start/End: Complemental strand, 4772883 - 4772834
Alignment:
| Q |
59 |
gtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
||||||| | |||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
4772883 |
gtgtattagaaaaaactcaagtttcacatcagatagatatgactcttgat |
4772834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 69 - 106
Target Start/End: Complemental strand, 4877507 - 4877470
Alignment:
| Q |
69 |
aaaaactcaagtcccacatcagatagataagactcttg |
106 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
4877507 |
aaaaactcaagtctcacatcagatagataagtctcttg |
4877470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 19860116 - 19860153
Alignment:
| Q |
1 |
ggttttgtaaggatgatttagg-ccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
19860116 |
ggttttgtaaggatgatttaggcccccaaatttcaaca |
19860153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 62 - 107
Target Start/End: Original strand, 21734408 - 21734453
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
||||||||||||| || ||||||||| |||||||||||||||||| |
|
|
| T |
21734408 |
tattgggaaaaacccacatcccacatcggatagataagactcttga |
21734453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 48 - 105
Target Start/End: Original strand, 25082796 - 25082852
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactctt |
105 |
Q |
| |
|
|||||||||| ||||| ||||||||| ||||| ||| |||||||||||||||||||| |
|
|
| T |
25082796 |
gcgtgagggg-gtgtaatgggaaaaatccaagttccatatcagatagataagactctt |
25082852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 59 - 108
Target Start/End: Complemental strand, 26847158 - 26847109
Alignment:
| Q |
59 |
gtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
||||||||| |||||| |||||||||||| |||||||| |||||||||| |
|
|
| T |
26847158 |
gtgtattggaaaaaacccaagtcccacattggatagataggactcttgat |
26847109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 62 - 134
Target Start/End: Original strand, 36264064 - 36264136
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgatc-gagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||| |||||| || |||||||||| ||||||||| ||||||||| | ||||| ||||||||||||||||| |
|
|
| T |
36264064 |
tattggtaaaaac-catgtcccacatcggatagataaaactcttgataagtgtttatatagaggaggcaatcct |
36264136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 3 - 44
Target Start/End: Original strand, 41002314 - 41002355
Alignment:
| Q |
3 |
ttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||| ||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
41002314 |
ttttataaggatgagttatgccccaaatttcaacatggtatc |
41002355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 902002 - 902034
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttc |
33 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
902002 |
ggttttgtaaggatgagttaggccccaaatttc |
902034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 5424807 - 5424771
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
5424807 |
ggttttgtaaggatgagttagaccccaaatttcaaca |
5424771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 6183391 - 6183355
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
6183391 |
ggttttgtaaggatgagttagaccccaaatttcaaca |
6183355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 2 - 38
Target Start/End: Complemental strand, 8044569 - 8044533
Alignment:
| Q |
2 |
gttttgtaaggatgatttaggccccaaatttcaacat |
38 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
8044569 |
gttttgtaaggatgagttaggtcccaaatttcaacat |
8044533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 62 - 102
Target Start/End: Original strand, 12343640 - 12343680
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagact |
102 |
Q |
| |
|
||||||||||||| || |||||||||| ||||||||||||| |
|
|
| T |
12343640 |
tattgggaaaaacacatgtcccacatctgatagataagact |
12343680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 20999014 - 20998978
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
20999014 |
ggttttgtaaggatgagttaggcccccaatttcaaca |
20998978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 25441775 - 25441811
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
25441775 |
ggttttgtaaggatgagttaggacccaaatttcaaca |
25441811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 25621310 - 25621274
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
25621310 |
ggttttgtaaggatgagttaggcccccaatttcaaca |
25621274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 44
Target Start/End: Complemental strand, 29695563 - 29695527
Alignment:
| Q |
8 |
taaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
29695563 |
taaggatgagttaggccccaaattttaacatggtatc |
29695527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 34775436 - 34775472
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
34775436 |
ggttttgtaaggatgagttaggcccccaatttcaaca |
34775472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 40010053 - 40010089
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40010053 |
ggttttgtaaggatgtgttaggccccaaatttcaaca |
40010089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 44403966 - 44403930
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
44403966 |
ggttttgtaaggatgagttaggtcccaaatttcaaca |
44403930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 53; Significance: 2e-21; HSPs: 72)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 48 - 108
Target Start/End: Original strand, 30065969 - 30066029
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30065969 |
gcgtgacgggggtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat |
30066029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 48 - 107
Target Start/End: Complemental strand, 8559804 - 8559745
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
8559804 |
gcgtgaggggggtgtattgggaaaaacccaagtcccacatcggatagataagactcttga |
8559745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 48 - 107
Target Start/End: Original strand, 15857157 - 15857216
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
15857157 |
gcgtgaggtgggtgtattgggaaaaactcaagtcccacatcggatagataagactcttga |
15857216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 50 - 134
Target Start/End: Original strand, 33435864 - 33435948
Alignment:
| Q |
50 |
gtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||| ||||||||||||||||||| ||||||| ||| ||||| ||||||| |
|
|
| T |
33435864 |
gtgagggg-gtgtattgggaaaaacccaagtcccacatcggatagataagactcttgataagagtttatataaaggagacaatcct |
33435948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 62 - 134
Target Start/End: Original strand, 43599303 - 43599376
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
43599303 |
tattgggaaaaactcaagtcccacatcggatagataagactcttgagaagagtttataaagaggaggcaatcct |
43599376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 48 - 134
Target Start/End: Complemental strand, 10989160 - 10989073
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||||||| ||||||||| |||||| ||||||||||||||| |||| ||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
10989160 |
gcgtgaggggggtgtattggaaaaaacccaagtcccacatcaggtagacaagactcttgagaagagtttataaagaggaggcaatcct |
10989073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 48 - 134
Target Start/End: Original strand, 35561644 - 35561731
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||||||| |||| ||||||||||| ||||||||||||| ||||||||||| |||||| ||||||| | ||||||||||||||| |
|
|
| T |
35561644 |
gcgtgaggggggtgtgttgggaaaaacccaagtcccacatcggatagataagattcttgagaagagtttataaagaggaggcaatcct |
35561731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 60 - 134
Target Start/End: Complemental strand, 43901131 - 43901056
Alignment:
| Q |
60 |
tgtattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||||||||||| || |||||||||| ||||||||||||||||||| ||||||| ||||||||| ||||||| |
|
|
| T |
43901131 |
tgtattgggaaaaacccatgtcccacatcggatagataagactcttgataagagtttatatagaggagacaatcct |
43901056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 48 - 102
Target Start/End: Original strand, 43599496 - 43599550
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagact |
102 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
43599496 |
gcgtgaggggggtgtattgggaaaaacccaagtcccacatcggatagataagact |
43599550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 50 - 107
Target Start/End: Original strand, 45122292 - 45122348
Alignment:
| Q |
50 |
gtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
45122292 |
gtgagggg-gtgtattgggaaaaacccaagtcccacatctgatagataagactcttga |
45122348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 10989266 - 10989223
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
10989266 |
ggttttgtaaggatgagttaggccccaaatttcaacatggtatc |
10989223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 57 - 108
Target Start/End: Original strand, 42447249 - 42447300
Alignment:
| Q |
57 |
gagtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
42447249 |
gagtgtattggaaaaaactcaagtcccacatcaaatagatacgactcttgat |
42447300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 43599390 - 43599433
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43599390 |
ggttttgtaaggatgagttaggccccaaatttcaacatggtatc |
43599433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 43984341 - 43984298
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43984341 |
ggttttgtaaggatgagttaggccccaaatttcaacatggtatc |
43984298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 62 - 134
Target Start/End: Complemental strand, 5720979 - 5720906
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
5720979 |
tattgggaaaaatccaagtcccacatcggatagataagactcttgagaagagtttataaagaggaggcaatcct |
5720906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 3 - 44
Target Start/End: Original strand, 7621975 - 7622016
Alignment:
| Q |
3 |
ttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7621975 |
ttttgtaaggatgagttaggccccaaatttcaacatggtatc |
7622016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 62 - 107
Target Start/End: Original strand, 8559573 - 8559618
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
8559573 |
tattgggaaaaacccaagtcccacatcggatagataagactcttga |
8559618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 62 - 134
Target Start/End: Original strand, 18313776 - 18313849
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||||||||| | |||||| ||||||||||||||||| |
|
|
| T |
18313776 |
tattgggaaaaatccaagtcccacatcggatagataagactcttgttaaaagtttatatagaggaggcaatcct |
18313849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 56 - 132
Target Start/End: Original strand, 25186758 - 25186835
Alignment:
| Q |
56 |
ggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatc |
132 |
Q |
| |
|
|||||||||||| |||||| |||||||||||| ||||||||||||||||||| |||||| ||||||||| ||||| |
|
|
| T |
25186758 |
ggagtgtattggaaaaaacctaagtcccacatcggatagataagactcttgataaaagtttatatagaggagacaatc |
25186835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 62 - 134
Target Start/End: Original strand, 33435671 - 33435744
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||| ||||||||| ||||||| ||| ||||| ||||||| |
|
|
| T |
33435671 |
tattgggaaaaactcaagtctcacatcggatagataaaactcttgataagagtttatataaaggagacaatcct |
33435744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 59 - 134
Target Start/End: Complemental strand, 8056352 - 8056276
Alignment:
| Q |
59 |
gtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||| ||| ||||||| || |||||||||| || |||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
8056352 |
gtgtgttgagaaaaacccatgtcccacatcggaaagataagactcttgataagagtttatatagaggaggcaatcct |
8056276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 63 - 134
Target Start/End: Complemental strand, 8056598 - 8056526
Alignment:
| Q |
63 |
attgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||| |||||| || |||||||||||||||||||||||||||||| | ||||| ||||||||| ||||||| |
|
|
| T |
8056598 |
attggaaaaaacacatgtcccacatcagatagataagactcttgataagtgtttatatagaggagacaatcct |
8056526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 48 - 107
Target Start/End: Complemental strand, 15010948 - 15010888
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactc-aagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||||||| |||||||||||||||| | |||||||||||| |||||| ||||||||||| |
|
|
| T |
15010948 |
gcgtgaggggggtgtattgggaaaaaccccaagtcccacatcggatagacaagactcttga |
15010888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 30065864 - 30065908
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatct |
45 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30065864 |
ggttttgtaaggatgggttaggccccaaatttcaacatggtatct |
30065908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 62 - 129
Target Start/End: Complemental strand, 30176576 - 30176508
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggca |
129 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| ||||||||||| ||||||| | |||||||||| |
|
|
| T |
30176576 |
tattgggaaaaactcaagtcccacatcggatagacgagactcttgatgagagtttataaagaggaggca |
30176508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 3183936 - 3183893
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
3183936 |
ggttttgtaacgatgagttaggccccaaatttcaacatggtatc |
3183893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 7729750 - 7729793
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
7729750 |
ggttttgtaaggatgagttaggccccaaatttctacatggtatc |
7729793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 8559660 - 8559703
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
8559660 |
ggttttgtaaggatgagttaggccccaaattacaacatggtatc |
8559703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 15011054 - 15011011
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
15011054 |
ggttttgtaaggatgagttaagccccaaatttcaacatggtatc |
15011011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 21653406 - 21653449
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
21653406 |
ggttttgtaaggatgagttaggctccaaatttcaacatggtatc |
21653449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 33435758 - 33435801
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
33435758 |
ggttttgtaaggatgagttagaccccaaatttcaacatggtatc |
33435801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 48 - 107
Target Start/End: Complemental strand, 37537220 - 37537162
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
37537220 |
gcgtgagggg-gtgaattgggaaaaactcaagtcccacatcgaatagataagacttttga |
37537162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 49 - 131
Target Start/End: Complemental strand, 39705839 - 39705756
Alignment:
| Q |
49 |
cgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaat |
131 |
Q |
| |
|
||||| ||| ||||||||||||||| ||| ||| |||||| |||| |||||||||||||| ||||||| ||| |||||||||| |
|
|
| T |
39705839 |
cgtgatgggggtgtattgggaaaaattcatgtctcacatcggataaataagactcttgataagagtttaaatacaggaggcaat |
39705756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 61 - 134
Target Start/End: Original strand, 3895123 - 3895196
Alignment:
| Q |
61 |
gtattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||||||||| |||| |||| | ||| ||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
3895123 |
gtattgggaaaa-ctcatgtcctatatcggatagataagactcttgataagagtttatatagaggaggcaatcct |
3895196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 20760685 - 20760647
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatg |
39 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
20760685 |
ggttttgtaaggatgagttaggccccaaatttcaacatg |
20760647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 10989059 - 10989022
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacat |
38 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10989059 |
ggttttgtaaggatgagttaggccccaaatttcaacat |
10989022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 62 - 134
Target Start/End: Complemental strand, 10989353 - 10989280
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||| |||||| ||||||||||||| |||||| ||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
10989353 |
tattggaaaaaacccaagtcccacatcggatagacaagactcttgagaagagtttataaagaggaggcaatcct |
10989280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 62 - 134
Target Start/End: Complemental strand, 15011141 - 15011068
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||| |||||| ||||||||||||| |||||| ||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
15011141 |
tattggaaaaaacccaagtcccacatcggatagacaagactcttgagaagagtttataaagaggaggcaatcct |
15011068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 16454660 - 16454623
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacat |
38 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
16454660 |
ggttttgtaaggatgagttaggccccaaatttcaacat |
16454623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 18905935 - 18905972
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacat |
38 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
18905935 |
ggttttgtaaggatgagttaggccccaaatttcaacat |
18905972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 62 - 107
Target Start/End: Complemental strand, 20760772 - 20760727
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||| ||||||||||| |
|
|
| T |
20760772 |
tattgggaaaaacccaagtcccacatcggatagacaagactcttga |
20760727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 36997245 - 36997282
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacat |
38 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36997245 |
ggttttgtaaggatgagttaggccccaaatttcaacat |
36997282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 62 - 134
Target Start/End: Complemental strand, 40902505 - 40902432
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||||||||| ||||| ||||||| |||||| ||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
40902505 |
tattgggaaaaacccaagttccacatcggatagacaagactcttgagaagagtttataaagaggaggcaatcct |
40902432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 43599551 - 43599588
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacat |
38 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43599551 |
ggttttgtaaggatgagttaggccccaaatttcaacat |
43599588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 48 - 107
Target Start/End: Complemental strand, 4196077 - 4196017
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaa-ctcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||||||| ||||||||||||||| | |||| |||||||| |||||| ||||||||||| |
|
|
| T |
4196077 |
gcgtgaggggggtgtattgggaaaaaccccaaggcccacatcggatagacaagactcttga |
4196017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 30066061 - 30066097
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30066061 |
ggttttgtaaggatgagttaggccccaaatttcaaca |
30066097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 32931480 - 32931516
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32931480 |
ggttttgtaaggatgagttaggccccaaatttcaaca |
32931516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 35561537 - 35561581
Alignment:
| Q |
1 |
ggttttgtaaggatgatttagg-ccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
35561537 |
ggttttgtaaggatgagttaggcccccaaatttcaacatggtatc |
35561581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 61 - 108
Target Start/End: Original strand, 5496552 - 5496599
Alignment:
| Q |
61 |
gtattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
5496552 |
gtattggaaaaaactcaagtcccacatcaaatagacgagactcttgat |
5496599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 48 - 130
Target Start/End: Complemental strand, 15968311 - 15968229
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaa |
130 |
Q |
| |
|
|||||| ||| ||||||| |||||| | || |||||||||||||||||| ||||| ||||| ||||||| ||||||||||||| |
|
|
| T |
15968311 |
gcgtgacgggggtgtatttggaaaacc-catgtcccacatcagatagattagacttttgataagagtttatatagaggaggcaa |
15968229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 59 - 98
Target Start/End: Original strand, 22188924 - 22188963
Alignment:
| Q |
59 |
gtgtattgggaaaaactcaagtcccacatcagatagataa |
98 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
22188924 |
gtgtattgggaaaaactcatgtcccacatcggatagataa |
22188963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 22277603 - 22277646
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
22277603 |
ggttttgtaaggatgagttaatccccaaatttcaacatggtatc |
22277646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 36037269 - 36037312
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||| |||||||| |
|
|
| T |
36037269 |
ggttttgtaaggatgagttagaccccaaatttcaatatggtatc |
36037312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 61 - 107
Target Start/End: Complemental strand, 8559911 - 8559866
Alignment:
| Q |
61 |
gtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||| |||||||||| |
|
|
| T |
8559911 |
gtattgggaaaaacccaagtcccacatcggatagat-agactcttga |
8559866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 62 - 108
Target Start/End: Original strand, 12941562 - 12941608
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| |||||| |||| |
|
|
| T |
12941562 |
tattgggaaaaacccaagtaccacatcagatagatgagactcatgat |
12941608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 30176489 - 30176451
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatg |
39 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
30176489 |
ggttttgtaaggatgagttaggccccgaatttcaacatg |
30176451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 3 - 37
Target Start/End: Original strand, 31767061 - 31767095
Alignment:
| Q |
3 |
ttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
31767061 |
ttttgtaaggatgagttaggccccaaatttcaaca |
31767095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 62 - 100
Target Start/End: Complemental strand, 41456607 - 41456569
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataaga |
100 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
41456607 |
tattgggaaaaactcatgtcccacattagatagataaga |
41456569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 15010846 - 15010809
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacat |
38 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
15010846 |
ggttttataaggatgagttaggccccaaatttcaacat |
15010809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 21653883 - 21653920
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacat |
38 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
21653883 |
ggttttgtaaggatgagttaggccccaaattacaacat |
21653920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 67 - 108
Target Start/End: Complemental strand, 30117543 - 30117502
Alignment:
| Q |
67 |
ggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
|||||||| ||||||||||||| ||||||| ||||||||||| |
|
|
| T |
30117543 |
ggaaaaacccaagtcccacatcggatagatgagactcttgat |
30117502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 69 - 106
Target Start/End: Complemental strand, 31711847 - 31711810
Alignment:
| Q |
69 |
aaaaactcaagtcccacatcagatagataagactcttg |
106 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
31711847 |
aaaaactcaagtctcacatcagatagataagtctcttg |
31711810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 62 - 134
Target Start/End: Complemental strand, 15968178 - 15968103
Alignment:
| Q |
62 |
tattgggaaaaactcaagtccc--acatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||||||||| || ||||| ||||||||| ||||||||||||||| ||||||| ||| ||||| ||||||| |
|
|
| T |
15968178 |
tattgggaaaaacccatgtcccccacatcagattgataagactcttgataagagtttatataaaggagacaatcct |
15968103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 20298541 - 20298505
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
20298541 |
ggttttgtaatgatgagttaggccccaaatttcaaca |
20298505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 21085173 - 21085137
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
21085173 |
ggttttgtaatgatgagttaggccccaaatttcaaca |
21085137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 22451427 - 22451463
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
22451427 |
ggttttgtaaggatgagttatgccccaaatttcaaca |
22451463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 2 - 42
Target Start/End: Complemental strand, 27402436 - 27402396
Alignment:
| Q |
2 |
gttttgtaaggatgatttaggccccaaatttcaacatggta |
42 |
Q |
| |
|
||||| ||||||||| |||||||||||||||| |||||||| |
|
|
| T |
27402436 |
gttttataaggatgagttaggccccaaatttctacatggta |
27402396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 34248438 - 34248470
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttc |
33 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
34248438 |
ggttttgtaaggatgagttaggccccaaatttc |
34248470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 36039819 - 36039783
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
36039819 |
ggttttgtaaggatgagttagaccccaaatttcaaca |
36039783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 36993972 - 36993936
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
36993972 |
ggttttgtaaggatgagttaggcctcaaatttcaaca |
36993936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 40902418 - 40902382
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||| |
|
|
| T |
40902418 |
ggttttgtaaggataagttaggccccaaatttcaaca |
40902382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 63 - 134
Target Start/End: Original strand, 42228764 - 42228836
Alignment:
| Q |
63 |
attgggaaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||||||| |||||||||||| |||||| ||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
42228764 |
attgggaaaaatctaagtcccacatcggatagacaagactcttgagaagagtttataaagaggaggcaatcct |
42228836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 52; Significance: 9e-21; HSPs: 74)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 48 - 134
Target Start/End: Complemental strand, 10903403 - 10903316
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||| ||| |||||||||||||||| || |||||||||| ||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
10903403 |
gcgtgacgggggtgtattgggaaaaacacatgtcccacatcggatagataagactcttgataagagtttatatagaggaggcaatcct |
10903316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 49 - 134
Target Start/End: Original strand, 9378979 - 9379065
Alignment:
| Q |
49 |
cgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||||||| |||||||||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
9378979 |
cgtgaggggagtgtattgggaaaaacccaagttccacatcggatagataagactcttgagaagagtttataaagaggaggcaatcct |
9379065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 62 - 134
Target Start/End: Complemental strand, 10903596 - 10903523
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
10903596 |
tattgggaaaaactcatgtcccacatcggatagataagactcttgataagagtttatatagaggaggcaatcct |
10903523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 48 - 134
Target Start/End: Original strand, 6783016 - 6783103
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||| |||||| |||||||||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
6783016 |
gcgtgaggggggtgtattgggaaaaacccaagtctcacatcggatagataagactcttgagaagagtttataaagaggaggcaatcct |
6783103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 60 - 108
Target Start/End: Complemental strand, 4258318 - 4258270
Alignment:
| Q |
60 |
tgtattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4258318 |
tgtattgggaaaaactcaagtcccacatcggatagataagactcttgat |
4258270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 48 - 108
Target Start/End: Original strand, 5266337 - 5266397
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
|||||| ||| |||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
5266337 |
gcgtgatgggggtgtattgggaaaaacccatgtcccacatcagatagataagactcttgat |
5266397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 48 - 108
Target Start/End: Original strand, 16565077 - 16565136
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
16565077 |
gcgtgagggg-gtgtattgggaaaaacccaagtcccacatcggatagataagactcttgat |
16565136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 48 - 108
Target Start/End: Complemental strand, 16600585 - 16600526
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
16600585 |
gcgtgagggg-gtgtattgggaaaaacccaagtcccacatcggatagataagactcttgat |
16600526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 59 - 134
Target Start/End: Original strand, 29646053 - 29646129
Alignment:
| Q |
59 |
gtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||||||||||| ||| ||||||||| ||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
29646053 |
gtgtattgggaaaaattcatgtcccacattggatagataagactcttgataggagtttatatagaggaggcaatcct |
29646129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 59 - 134
Target Start/End: Original strand, 33834144 - 33834220
Alignment:
| Q |
59 |
gtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||||||||| ||||||| ||||||||| ||||||| |
|
|
| T |
33834144 |
gtgtattgggaaaaatccatgtcccacatcagatagataagactcttgataagagtttatatagaggagacaatcct |
33834220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 48 - 108
Target Start/End: Original strand, 48113975 - 48114035
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
|||||||||| |||||||||||| ||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
48113975 |
gcgtgaggggggtgtattgggaataacccaagtcccacatcggatagataagactcttgat |
48114035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 48 - 134
Target Start/End: Complemental strand, 6751631 - 6751544
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||| ||| ||||||| ||||||||||| ||||||| | |||||||||| |||| |
|
|
| T |
6751631 |
gcgtgaggggggtgtattgggaaaaacccaagtcccaaatcggatagatgagactcttgatgagagtttacaaagaggaggcactcct |
6751544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 48 - 125
Target Start/End: Original strand, 23390568 - 23390646
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagagga |
125 |
Q |
| |
|
|||||| ||| |||||||||||||||| || |||||||||| ||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
23390568 |
gcgtgacgggggtgtattgggaaaaacccatgtcccacatcggatagataagactcttgataagagtttatatagagga |
23390646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 61 - 134
Target Start/End: Complemental strand, 31357788 - 31357714
Alignment:
| Q |
61 |
gtattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||||||||||| || |||||||||| ||||||||||||||||||| ||||||| ||||||||| ||||||| |
|
|
| T |
31357788 |
gtattgggaaaaacccatgtcccacatcggatagataagactcttgataagagtttatatagaggagacaatcct |
31357714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 62 - 131
Target Start/End: Complemental strand, 35866751 - 35866681
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaat |
131 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||||||||||| ||||||| ||||||| |||||| |
|
|
| T |
35866751 |
tattgggaaaaacccaagtcccacatcggatagataagactcttgataagagtttatatagagggggcaat |
35866681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 48 - 108
Target Start/End: Complemental strand, 4258125 - 4258066
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||| |||||| ||||||||||||||||||| |
|
|
| T |
4258125 |
gcgtgagggg-gtgtattgggaaaaacccaagtctcacatcggatagataagactcttgat |
4258066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 13310450 - 13310407
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
13310450 |
ggttttgtaaggatgagttaggccccaaatttcaacatggtatc |
13310407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 23396688 - 23396731
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
23396688 |
ggttttgtaaggatgagttaggccccaaatttcaacatggtatc |
23396731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 23821701 - 23821659
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtat |
43 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
23821701 |
ggttttgtaaggatgagttaggccccaaatttcaacatggtat |
23821659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 50 - 108
Target Start/End: Original strand, 33855672 - 33855729
Alignment:
| Q |
50 |
gtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||| |||||||||||||| |||| |
|
|
| T |
33855672 |
gtgagggg-gtgtattgggaaaaacccaagtcccacatcggatagataagactcatgat |
33855729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 62 - 107
Target Start/End: Original strand, 2179646 - 2179691
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
2179646 |
tattgggaaaaattcaagtcccacatcggatagataagactcttga |
2179691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 62 - 134
Target Start/End: Original strand, 6782818 - 6782891
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||||||||| |||||| |||||| |||||||||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
6782818 |
tattgggaaaaacccaagtctcacatcggatagataagactcttgagaagagtttataaagaggaggcaatcct |
6782891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 62 - 134
Target Start/End: Complemental strand, 7833075 - 7833002
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||| ||||||||||| ||| |||| |||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
7833075 |
tattaggaaaaactcatgtctcacactagatagataagactcttgataggagtttatatagaggaggcaatcct |
7833002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 62 - 134
Target Start/End: Original strand, 9378785 - 9378858
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
9378785 |
tattgggaaaaacccaagtcccacatcgaatagataagactcttgagaagagtttataaagaggaggcaatcct |
9378858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 62 - 134
Target Start/End: Original strand, 29252568 - 29252641
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||||||||| |||||||||| || |||||||||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
29252568 |
tattgggaaaaacccaagtcccacgtcggatagataagactcttgagaagagtttataaagaggaggcaatcct |
29252641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 59 - 108
Target Start/End: Original strand, 30768407 - 30768456
Alignment:
| Q |
59 |
gtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
||||||| ||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
30768407 |
gtgtattaggaaaaactcatgtcccacatcggatagataagactcttgat |
30768456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 62 - 134
Target Start/End: Original strand, 33833942 - 33834015
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||| |||||| || |||||||||| ||||||||||||||||||| ||||||| ||||||||| ||||||| |
|
|
| T |
33833942 |
tattggaaaaaacccatgtcccacatcggatagataagactcttgataagagtttatatagaggagacaatcct |
33834015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 3 - 44
Target Start/End: Original strand, 33855566 - 33855607
Alignment:
| Q |
3 |
ttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33855566 |
ttttgtaaggatgagttaggccccaaatttcaacatggtatc |
33855607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 62 - 134
Target Start/End: Complemental strand, 39808709 - 39808636
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||| ||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
39808709 |
tattgggaaaaacccaagtcccacatcggatagacaagactcttgagaagagtttataaagaggaggcaatcct |
39808636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 48 - 134
Target Start/End: Original strand, 2232073 - 2232161
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaac-tcaagtcccacatcagatagataagactcttgatc-gagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||| ||||| ||||||||| |||||| |||||||| |||| ||||||||| ||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
2232073 |
gcgttaggggggtgtattggaaaaaacctcaagtcctgcatcggatagataaaactcttgataagagtttatatagaggaggcaatcct |
2232161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 62 - 105
Target Start/End: Original strand, 16564886 - 16564929
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactctt |
105 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
16564886 |
tattgggaaaaacccaagtcccacatcggatagataagactctt |
16564929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 62 - 105
Target Start/End: Complemental strand, 16600776 - 16600733
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactctt |
105 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
16600776 |
tattgggaaaaacccaagtcccacatcggatagataagactctt |
16600733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 1663629 - 1663592
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacat |
38 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1663629 |
ggttttgtaaggatgagttaggccccaaatttcaacat |
1663592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 62 - 134
Target Start/End: Original strand, 5775874 - 5775947
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |||||||| || ||||||| | |||||||||| |||| |
|
|
| T |
5775874 |
tattgggaaaaactcaagtcccacatcgcatagatgagactcttaatgagagtttataaagaggaggcactcct |
5775947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 62 - 107
Target Start/End: Complemental strand, 6214347 - 6214302
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||| ||||||||||| |
|
|
| T |
6214347 |
tattgggaaaaacccaagtcccacatcggatagacaagactcttga |
6214302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 62 - 134
Target Start/End: Complemental strand, 6751821 - 6751748
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||| ||| ||||||| ||||||| | |||||||||| |||| |
|
|
| T |
6751821 |
tattgggaaaaacccaagtcccacatcggatagatgagattcttgatgagagtttacaaagaggaggcactcct |
6751748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 76 - 132
Target Start/End: Original strand, 8681890 - 8681947
Alignment:
| Q |
76 |
caagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatc |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| | ||| ||||||||| |
|
|
| T |
8681890 |
caagtcccacatcagatagataagactcttgataagagtttataaagaagaggcaatc |
8681947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 48 - 132
Target Start/End: Original strand, 23396794 - 23396877
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatc |
132 |
Q |
| |
|
|||||||||| |||||||||||||| | ||||||||||| || |||||||||||||||||| |||| || | ||||||||||||| |
|
|
| T |
23396794 |
gcgtgagggg-gtgtattgggaaaatc-caagtcccacaacatatagataagactcttgataagagtatataaagaggaggcaatc |
23396877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 48 - 105
Target Start/End: Complemental strand, 23821597 - 23821540
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactctt |
105 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||||||| ||||||| |||||||| |
|
|
| T |
23821597 |
gcgtgagggaggtgtattgggaaaaacccaagtcccacataggatagatgagactctt |
23821540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 6783117 - 6783153
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6783117 |
ggttttgtaaggatgagttaggccccaaatttcaaca |
6783153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 59 - 134
Target Start/End: Complemental strand, 6813193 - 6813117
Alignment:
| Q |
59 |
gtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||| ||||||||||| ||||||||||||| ||||||| |||||||||| ||||||| | |||||||||| |||| |
|
|
| T |
6813193 |
gtgtgttgggaaaaacacaagtcccacatcggatagatgggactcttgatgagagtttataaagaggaggcactcct |
6813117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 64 - 108
Target Start/End: Original strand, 31374964 - 31375008
Alignment:
| Q |
64 |
ttgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
||||||||||| |||||||| ||| |||||||||||||||||||| |
|
|
| T |
31374964 |
ttgggaaaaacacaagtcccgcataagatagataagactcttgat |
31375008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 41670912 - 41670948
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
41670912 |
ggttttgtaaggatgagttaggccccaaatttcaaca |
41670948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 258508 - 258551
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||| | ||||| ||||||||||||||||||||||||||| |
|
|
| T |
258508 |
ggttttgtgatgatgagttaggccccaaatttcaacatggtatc |
258551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 8681963 - 8682006
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
||||||||||| |||| ||||||| ||||||||||||||||||| |
|
|
| T |
8681963 |
ggttttgtaagaatgagttaggcctcaaatttcaacatggtatc |
8682006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 9378872 - 9378915
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| |||| ||||||||| |||||||||||| |
|
|
| T |
9378872 |
ggttttgtaaggatgagttagaccccaaattacaacatggtatc |
9378915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 12524914 - 12524957
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
12524914 |
ggttttgtaaggatggattatgccccaaatttcaacatggtatc |
12524957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 29780226 - 29780269
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
29780226 |
ggttttataaggatgagttaggccccaaatttcaatatggtatc |
29780269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 257292 - 257258
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaa |
35 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |
|
|
| T |
257292 |
ggttttgtaaggatgagttaggccccaaatttcaa |
257258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 62 - 108
Target Start/End: Original strand, 21557008 - 21557054
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
21557008 |
tattggaaaaaactcaagtcccacatcggatagatagaactcttgat |
21557054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 61 - 134
Target Start/End: Complemental strand, 24377957 - 24377883
Alignment:
| Q |
61 |
gtattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||||||||||||| ||||| |||| ||||||||| ||| ||||| ||||||| ||||| ||| ||||||| |
|
|
| T |
24377957 |
gtattgggaaaaactcatgtcccgcatcggatagataaaacttttgataggagtttatatagatgagacaatcct |
24377883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 69 - 134
Target Start/End: Original strand, 29645814 - 29645880
Alignment:
| Q |
69 |
aaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||||| || |||||| ||||||||||||||||||| ||||||| ||| ||||||||||||| |
|
|
| T |
29645814 |
aaaaactcatgtttcacatcggatagataagactcttgatatgagtttatataaaggaggcaatcct |
29645880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 62 - 108
Target Start/End: Original strand, 33855473 - 33855519
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
||||||||||||| ||||||||| ||| |||||||||||||| |||| |
|
|
| T |
33855473 |
tattgggaaaaacccaagtcccatatcggatagataagactcgtgat |
33855519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 62 - 131
Target Start/End: Complemental strand, 38948525 - 38948455
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaat |
131 |
Q |
| |
|
|||||||||||| ||| |||||||||| || ||||||||||||| || ||||||| ||||||||| |||| |
|
|
| T |
38948525 |
tattgggaaaaaatcatgtcccacatcggaaagataagactctttataagagtttatatagaggagacaat |
38948455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 40703436 - 40703402
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaa |
35 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |
|
|
| T |
40703436 |
ggttttgtaaggatgagttaggccccaaatttcaa |
40703402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 62 - 108
Target Start/End: Complemental strand, 40703971 - 40703925
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
|||| |||||| ||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
40703971 |
tatttggaaaagctcaagtcccacatcggatagatgagactcttgat |
40703925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 69 - 126
Target Start/End: Original strand, 49040565 - 49040623
Alignment:
| Q |
69 |
aaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggag |
126 |
Q |
| |
|
||||||||| ||| |||||| ||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
49040565 |
aaaaactcatgtctcacatcggatagataagactcttgataagagtttatatagaggag |
49040623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 62 - 134
Target Start/End: Complemental strand, 6813395 - 6813322
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||||||| | |||||||| |||||||||||| |||||||||| ||||||| | |||||||||| |||| |
|
|
| T |
6813395 |
tattgggaaaaccccaagtcccgcatcagatagatgggactcttgatgagagtttataaagaggaggcactcct |
6813322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 62 - 134
Target Start/End: Original strand, 22841044 - 22841117
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||||||||| || | || ||||| ||||||||||||||||| | ||||||| ||||||||| ||||||| |
|
|
| T |
22841044 |
tattgggaaaaacccatgccctacatcggatagataagactcttggtaagagtttatatagaggagacaatcct |
22841117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 62 - 107
Target Start/End: Original strand, 23396601 - 23396646
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||||||||| ||||||||||| | |||||||||||||||||| |
|
|
| T |
23396601 |
tattgggaaaaatccaagtcccacaacggatagataagactcttga |
23396646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 4 - 49
Target Start/End: Complemental strand, 40703881 - 40703836
Alignment:
| Q |
4 |
tttgtaaggatgatttaggccccaaatttcaacatggtatctacgc |
49 |
Q |
| |
|
||||||||||||| ||| |||||||||||||| |||||||| |||| |
|
|
| T |
40703881 |
tttgtaaggatgagttatgccccaaatttcaatatggtatcaacgc |
40703836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 1661216 - 1661180
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
1661216 |
ggttttgtaagaatgagttaggccccaaatttcaaca |
1661180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 44
Target Start/End: Complemental strand, 4258222 - 4258186
Alignment:
| Q |
8 |
taaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
4258222 |
taaggatgaattaggcctcaaatttcaacatggtatc |
4258186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 6813103 - 6813067
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
6813103 |
ggttttgtgaggatgagttaggccccaaatttcaaca |
6813067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 8585170 - 8585206
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
8585170 |
ggttttgtaaggatgagttagaccccaaatttcaaca |
8585206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 12518195 - 12518159
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
12518195 |
ggttttgtaaggatgagttaggccccaaattttaaca |
12518159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 23396893 - 23396929
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
23396893 |
ggttttgtaaggatgagttagaccccaaatttcaaca |
23396929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 28910111 - 28910147
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
28910111 |
ggttttgtaaggatgagttagcccccaaatttcaaca |
28910147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 28910244 - 28910280
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
28910244 |
ggttttgtaaggatgagttagcccccaaatttcaaca |
28910280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 33855770 - 33855806
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
33855770 |
ggttttgtaagaatgagttaggccccaaatttcaaca |
33855806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 34590607 - 34590643
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
34590607 |
ggttttgtaaggatgagttaagccccaaatttcaaca |
34590643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 40121643 - 40121607
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
40121643 |
ggttttgtaaggatgagttacgccccaaatttcaaca |
40121607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 43167918 - 43167882
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
43167918 |
ggttttgtaaggatgagttaagccccaaatttcaaca |
43167882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 70 - 129
Target Start/End: Complemental strand, 47856095 - 47856035
Alignment:
| Q |
70 |
aaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggca |
129 |
Q |
| |
|
||||| ||| ||||||||| ||||||||||||||||||| ||||||| | |||||||||| |
|
|
| T |
47856095 |
aaaacccaaatcccacatcggatagataagactcttgataagagtttataaagaggaggca |
47856035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 52; Significance: 9e-21; HSPs: 103)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 48 - 134
Target Start/End: Original strand, 3640434 - 3640521
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||| ||| ||||||||||||||||||| ||||||||| ||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
3640434 |
gcgtgacgggggtgtattgggaaaaactcatctcccacatcggatagataagactcttgataagagtttaaatagaggaggcaatcct |
3640521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 48 - 134
Target Start/End: Original strand, 28245971 - 28246058
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||| ||||||| ||||||||||| ||||||| | |||| |||||||||| |
|
|
| T |
28245971 |
gcgtgaggggggtgtattgggaaaaacccaagtcccacatcggatagatgagactcttgatgagagtttataaagagaaggcaatcct |
28246058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 48 - 134
Target Start/End: Original strand, 29113427 - 29113514
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||| ||| |||||||||||||||| || ||||||||||||||||||||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
29113427 |
gcgtgacgggggtgtattgggaaaaacccatgtcccacatcagatagataagactcttgagaagagtttataaagaggaggcaatcct |
29113514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 48 - 107
Target Start/End: Original strand, 39110885 - 39110944
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39110885 |
gcgtaaggggggtgtattgggaaaaactcaagtcccacatcggatagataagactcttga |
39110944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 48 - 107
Target Start/End: Complemental strand, 1923117 - 1923058
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||| ||| |||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
1923117 |
gcgtgacgggggtgtattgggaaaaacccatgtcccacatcagatagataagactcttga |
1923058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 48 - 107
Target Start/End: Original strand, 5066038 - 5066096
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
5066038 |
gcgtgagggg-gtgtattgggaaaaattcaagtcccacatcagataaataagactcttga |
5066096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 48 - 134
Target Start/End: Complemental strand, 8305081 - 8304994
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||| ||| ||||||||||||||||||| |||| ||||| ||||||||||||| ||||| ||||||| ||||||||| ||||||| |
|
|
| T |
8305081 |
gcgtgacgggggtgtattgggaaaaactcatgtcctacatcggatagataagacttttgataagagtttatatagaggagacaatcct |
8304994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 53739945 - 53739988
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53739945 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
53739988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 61 - 134
Target Start/End: Original strand, 3640197 - 3640271
Alignment:
| Q |
61 |
gtattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||||||||||||| ||||||| || ||||||||||||||||||| ||||||| ||||||||| ||||||| |
|
|
| T |
3640197 |
gtattgggaaaaactcatgtcccacgtcggatagataagactcttgataagagtttatatagaggagacaatcct |
3640271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 61 - 134
Target Start/End: Complemental strand, 47491959 - 47491885
Alignment:
| Q |
61 |
gtattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||||||||||| || |||||||||| ||||||||||||||||||| ||||||| ||| ||||||||||||| |
|
|
| T |
47491959 |
gtattgggaaaaacccatgtcccacatcggatagataagactcttgataggagtttatataaaggaggcaatcct |
47491885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 58 - 134
Target Start/End: Complemental strand, 7892767 - 7892691
Alignment:
| Q |
58 |
agtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||||||||| ||||||| ||||||||| ||||||| |
|
|
| T |
7892767 |
agtgtattgggaaaat-tcaagtcccacatcggatagataagactcttgatatgagtttatatagaggagacaatcct |
7892691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 54 - 134
Target Start/End: Complemental strand, 12016803 - 12016722
Alignment:
| Q |
54 |
ggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||| |||||| ||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
12016803 |
ggggggtgtattgggaaaaacccaagtcccacatcggatagacaagactcttgagaagagtttataaagaggaggcaatcct |
12016722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 62 - 134
Target Start/End: Complemental strand, 25753717 - 25753644
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||| |||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
25753717 |
tattgggaaaaacccaagtcccacatcggatagacaagactcttgataagagtttataaagaggaggcaatcct |
25753644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 62 - 134
Target Start/End: Original strand, 43943665 - 43943738
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
43943665 |
tattgggaaaaacccaagtcccacatcggatagataagactcttgagaagagtttataaagaggaggcaatcct |
43943738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 59 - 134
Target Start/End: Original strand, 14945132 - 14945208
Alignment:
| Q |
59 |
gtgtattgggaaaaactcaagtcccacatcagatagataagactctt-gatcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||||||||||||| || |||||||||| |||||||||||||||| || ||||||| |||||||| |||||||| |
|
|
| T |
14945132 |
gtgtattgggaaaaacacatgtcccacatcggatagataagactcttcgaaagagtttatatagaggatgcaatcct |
14945208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 51 - 107
Target Start/End: Original strand, 21498512 - 21498568
Alignment:
| Q |
51 |
tgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||||| |||||| ||||||||||| |
|
|
| T |
21498512 |
tgaggggggtgtattgggaaaaacccaagtcccacatcggatagacaagactcttga |
21498568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 62 - 134
Target Start/End: Original strand, 28395170 - 28395242
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgatcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||||||||| |||| || | ||||||||||||||| |
|
|
| T |
28395170 |
tattgggaaaaacccaagtcccacattggatagataagactcttgaaagagtatataaagaggaggcaatcct |
28395242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 62 - 129
Target Start/End: Complemental strand, 28497326 - 28497258
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggca |
129 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||||||||||| ||||||| | |||||||||| |
|
|
| T |
28497326 |
tattgggaaaaacccaagtcccacatcggatagataagactcttgataagagtttataaagaggaggca |
28497258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 990626 - 990669
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
990626 |
ggttttgtaaggatgagttaggccccaaatttcaacatggtatc |
990669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 48 - 107
Target Start/End: Complemental strand, 40716762 - 40716703
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||| ||| ||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40716762 |
gcgtgaagggggtgtattggaaaaaactcaagtcccacatcgtatagataagactcttga |
40716703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 45427277 - 45427234
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
45427277 |
ggttttgtaaggatgagttaggccccaaatttcaacatggtatc |
45427234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 48 - 107
Target Start/End: Complemental strand, 53559431 - 53559372
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||||||||| ||||||||| |||||||| |
|
|
| T |
53559431 |
gcgtgaggggggtgtattgggaaaaaaccaagtcccacatcggatagataaaactcttga |
53559372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 56511376 - 56511419
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
56511376 |
ggttttgtaaggatgagttaggccccaaatttcaacatggtatc |
56511419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 48 - 134
Target Start/End: Original strand, 56511482 - 56511569
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||||||| ||||||||||||||||| ||||||| | |||||||||| |||| |
|
|
| T |
56511482 |
gcgtgaggggggtgtattgggaaaaacccaagtcccacattgagtagataagactcttgataagagtttataaagaggaggcactcct |
56511569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 61 - 134
Target Start/End: Complemental strand, 8560084 - 8560010
Alignment:
| Q |
61 |
gtattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||||||||||| ||||||| || |||||||||||||| |
|
|
| T |
8560084 |
gtattgggaaaagtccaagtcccacatcggatagataagactcttgataagagtttatatcgaggaggcaatcct |
8560010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 62 - 134
Target Start/End: Original strand, 5488359 - 5488432
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||||||||| ||||||||||||| |||| ||||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
5488359 |
tattgggaaaaacccaagtcccacatcggataaataagactcttgagaagagtttataaagaggaggcaatcct |
5488432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 62 - 134
Target Start/End: Complemental strand, 12017003 - 12016930
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||| ||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
12017003 |
tattgggaaaaacccaagtcccacatcggatagacaagactcttgagaagagtttataaagaggaggcaatcct |
12016930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 62 - 134
Target Start/End: Original strand, 14944886 - 14944959
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||| |||||||||| || ||||||||||||||||||||||||| | ||||||| ||||||||||| ||||| |
|
|
| T |
14944886 |
tattgagaaaaactcatgttccacatcagatagataagactcttggtaagagtttacatagaggaggcgatcct |
14944959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 59 - 108
Target Start/End: Complemental strand, 17077055 - 17077006
Alignment:
| Q |
59 |
gtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||| ||||||||||| |
|
|
| T |
17077055 |
gtgtattgggaaaaacccaagtcccacatcggatagatgagactcttgat |
17077006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 62 - 134
Target Start/End: Original strand, 28245783 - 28245853
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgatcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||| |||||| ||| ||||||| | ||||||||||||||| |
|
|
| T |
28245783 |
tattgggaaaaacccaagtcccacatcggatagatgagactcatga--gagtttataaagaggaggcaatcct |
28245853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 60 - 108
Target Start/End: Complemental strand, 17077258 - 17077210
Alignment:
| Q |
60 |
tgtattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||| ||||||||||| |
|
|
| T |
17077258 |
tgtattgggaaaaacccaagtcccacatcggatagatgagactcttgat |
17077210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 59 - 107
Target Start/End: Complemental strand, 27634441 - 27634393
Alignment:
| Q |
59 |
gtgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
27634441 |
gtgtattgggaaaaaccaaagtcccacatcggatagataagactcttga |
27634393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 48 - 108
Target Start/End: Original strand, 33629900 - 33629959
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
33629900 |
gcgtgagggg-gtgtatcgggaaaaactcaagtcccacattggatagatgagactcttgat |
33629959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 60 - 108
Target Start/End: Complemental strand, 53720784 - 53720736
Alignment:
| Q |
60 |
tgtattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||||||| ||||| |
|
|
| T |
53720784 |
tgtattgggaaaaactgaagtcccacatcggatagataagacttttgat |
53720736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 5 - 44
Target Start/End: Complemental strand, 1923217 - 1923178
Alignment:
| Q |
5 |
ttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
1923217 |
ttgtaaggatgagttaggccccaaatttcaacatggtatc |
1923178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 12016916 - 12016873
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
12016916 |
ggttttgtaaggatgagttaggcccccaatttcaacatggtatc |
12016873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 15664915 - 15664958
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
15664915 |
ggttttgtaacgatgagttaggccccaaatttcaacatggtatc |
15664958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 17077169 - 17077126
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
17077169 |
ggttttgtaaggttgagttaggccccaaatttcaacatggtatc |
17077126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 21498610 - 21498653
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
21498610 |
ggttttgtaaggatgagttaggccccaaattacaacatggtatc |
21498653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 27048433 - 27048390
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
27048433 |
ggttttgtaaggatgagttaggtcccaaatttcaacatggtatc |
27048390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 28245867 - 28245910
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
28245867 |
ggttttgtaaggatgagttaggcccccaatttcaacatggtatc |
28245910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 35399441 - 35399398
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
35399441 |
ggttttgtaaggttgagttaggccccaaatttcaacatggtatc |
35399398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 50858091 - 50858134
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
50858091 |
ggttttgtaaggatgagttaggccccaaatttcaacacggtatc |
50858134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 51469560 - 51469603
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
51469560 |
ggttgtgtaaggatgagttaggccccaaatttcaacatggtatc |
51469603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 2 - 44
Target Start/End: Complemental strand, 10390499 - 10390457
Alignment:
| Q |
2 |
gttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
10390499 |
gttttgtaaggatgagttagaccccaaatttcaacatggtatc |
10390457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 57 - 134
Target Start/End: Original strand, 56511284 - 56511362
Alignment:
| Q |
57 |
gagtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||||||||||| ||||||| | |||||||||| |||| |
|
|
| T |
56511284 |
gagtgtattgggaaaaacccaagtcccacattgagtagataagactcttgataagagtttataaagaggaggcactcct |
56511362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 51 - 108
Target Start/End: Original strand, 3055764 - 3055821
Alignment:
| Q |
51 |
tgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
||||||| ||| |||||||||||| |||||||||||| |||||||| |||||||||| |
|
|
| T |
3055764 |
tgaggggggtgaattgggaaaaacccaagtcccacattggatagataggactcttgat |
3055821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 62 - 107
Target Start/End: Original strand, 5065845 - 5065890
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||| ||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
5065845 |
tattggaaaaaactcaagtctcacatcggatagataagactcttga |
5065890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 3 - 44
Target Start/End: Complemental strand, 20545935 - 20545894
Alignment:
| Q |
3 |
ttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
20545935 |
ttttgtaatgatgagttaggccccaaatttcaacatggtatc |
20545894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 4 - 45
Target Start/End: Complemental strand, 21646826 - 21646785
Alignment:
| Q |
4 |
tttgtaaggatgatttaggccccaaatttcaacatggtatct |
45 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
21646826 |
tttgtaaggatgagttagaccccaaatttcaacatggtatct |
21646785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 3 - 44
Target Start/End: Complemental strand, 27634349 - 27634308
Alignment:
| Q |
3 |
ttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
27634349 |
ttttgtaaggatgagttaggccccaaattacaacatggtatc |
27634308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 56 - 132
Target Start/End: Complemental strand, 42561984 - 42561907
Alignment:
| Q |
56 |
ggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatc |
132 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| |||| |||||||||||||| | |||| ||||||||||||||| |
|
|
| T |
42561984 |
ggagtgtattgggaaaaactcatatcctacatcggatatataagactcttgataaaattttatatagaggaggcaatc |
42561907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 59 - 108
Target Start/End: Complemental strand, 45684289 - 45684240
Alignment:
| Q |
59 |
gtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
|||||||||||||||| || |||||||||| |||||||| |||||||||| |
|
|
| T |
45684289 |
gtgtattgggaaaaacccatgtcccacatcggatagatacgactcttgat |
45684240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 62 - 134
Target Start/End: Complemental strand, 49380992 - 49380919
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||||||||| |||||| |||||| |||||||||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
49380992 |
tattgggaaaaatccaagtctcacatcggatagataagactcttgagaagagtttataaagaggaggcaatcct |
49380919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 50858404 - 50858441
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacat |
38 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
50858404 |
ggttttgtaaggatgagttaggccccaaatttcaacat |
50858441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 51470562 - 51470599
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacat |
38 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
51470562 |
ggttttgtaaggatgagttaggccccaaatttcaacat |
51470599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 51470723 - 51470760
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacat |
38 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
51470723 |
ggttttgtaaggatgagttaggccccaaatttcaacat |
51470760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 62 - 107
Target Start/End: Original strand, 54210369 - 54210414
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||| ||||||||||| |
|
|
| T |
54210369 |
tattgggaaaaacccaagtcccacatcggatagacaagactcttga |
54210414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 23018549 - 23018585
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
23018549 |
ggttttgtaaggatgagttaggccccaaatttcaaca |
23018585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 27048162 - 27048126
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
27048162 |
ggttttgtaaggatgagttaggccccaaatttcaaca |
27048126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 28395256 - 28395292
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28395256 |
ggttttgtaaggatgagttaggccccaaatttcaaca |
28395292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 29113528 - 29113564
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
29113528 |
ggttttgtaaggatgagttaggccccaaatttcaaca |
29113564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 29669388 - 29669352
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
29669388 |
ggttttgtaaggatgagttaggccccaaatttcaaca |
29669352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 32987496 - 32987460
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32987496 |
ggttttgtaaggatgatttaggccctaaatttcaaca |
32987460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 59 - 103
Target Start/End: Original strand, 33629852 - 33629896
Alignment:
| Q |
59 |
gtgtattgggaaaaactcaagtcccacatcagatagataagactc |
103 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||| |||||| |
|
|
| T |
33629852 |
gtgtattgggaaaaacccaagtcccacatcggatagatgagactc |
33629896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 36558491 - 36558455
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
36558491 |
ggttttgtaaggatgagttaggccccaaatttcaaca |
36558455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 83 - 134
Target Start/End: Original strand, 41743549 - 41743601
Alignment:
| Q |
83 |
cacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
41743549 |
cacattagatagataagactcttgataagagtttatatagaggaggcaatcct |
41743601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 67 - 107
Target Start/End: Original strand, 50307273 - 50307313
Alignment:
| Q |
67 |
ggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
50307273 |
ggaaaaacccaagtcccacatcggatagataagactcttga |
50307313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 52214694 - 52214730
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
52214694 |
ggttttgtaaggatgagttaggccccaaatttcaaca |
52214730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 53740261 - 53740297
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
53740261 |
ggttttgtaaggatgagttaggccccaaatttcaaca |
53740297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 5488446 - 5488489
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||| |||| |
|
|
| T |
5488446 |
ggttttgtaaggatgagttaggcctcaaatttcaacatgatatc |
5488489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 27634556 - 27634513
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||| ||||| |||||||||||||| |||||||||||| |
|
|
| T |
27634556 |
ggttttgtaacgatgagttaggccccaaattacaacatggtatc |
27634513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 29669703 - 29669660
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
29669703 |
ggttttgtaaggatgagttaaaccccaaatttcaacatggtatc |
29669660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 33629738 - 33629781
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||| | ||||| ||||||||||||||||||||||||||| |
|
|
| T |
33629738 |
ggttttgtgacgatgagttaggccccaaatttcaacatggtatc |
33629781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 34206280 - 34206237
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
||||| |||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
34206280 |
ggtttcgtaaggatgagttaggccccaaatctcaacatggtatc |
34206237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 43972434 - 43972469
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaac |
36 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43972434 |
ggttttgtaaggatgagttaggccccaaatttcaac |
43972469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 45426961 - 45426926
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaac |
36 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
45426961 |
ggttttgtaaggatgagttaggccccaaatttcaac |
45426926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 2 - 37
Target Start/End: Complemental strand, 53738232 - 53738197
Alignment:
| Q |
2 |
gttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |
|
|
| T |
53738232 |
gttttgtaaggatgacttaggccccaaatttcaaca |
53738197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 3 - 38
Target Start/End: Original strand, 56511585 - 56511620
Alignment:
| Q |
3 |
ttttgtaaggatgatttaggccccaaatttcaacat |
38 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
56511585 |
ttttgtaaggatgagttaggccccaaatttcaacat |
56511620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 2 - 36
Target Start/End: Complemental strand, 400407 - 400373
Alignment:
| Q |
2 |
gttttgtaaggatgatttaggccccaaatttcaac |
36 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
400407 |
gttttgtaaggatgagttaggccccaaatttcaac |
400373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 62 - 108
Target Start/End: Complemental strand, 21647693 - 21647647
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
||||| |||||| |||||||||||||| |||||||| |||||||||| |
|
|
| T |
21647693 |
tattgagaaaaattcaagtcccacatcggatagatatgactcttgat |
21647647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 62 - 108
Target Start/End: Original strand, 22865762 - 22865807
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||| |||||| |
|
|
| T |
22865762 |
tattgggaaaaactcaagt-ccacatcggatagataagacccttgat |
22865807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 62 - 108
Target Start/End: Original strand, 23350791 - 23350837
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
||||||||||||| ||| ||||||||| |||| |||||||||||||| |
|
|
| T |
23350791 |
tattgggaaaaacccaaatcccacatcggataaataagactcttgat |
23350837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 62 - 108
Target Start/End: Original strand, 26806503 - 26806549
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
||||||||||||| ||||||||| ||| |||||||| |||||||||| |
|
|
| T |
26806503 |
tattgggaaaaacccaagtcccaaatcggatagataggactcttgat |
26806549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 62 - 108
Target Start/End: Original strand, 55100090 - 55100136
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||| |||||||||| |
|
|
| T |
55100090 |
tattgggaaaaatccaagtcccacattagatagatatgactcttgat |
55100136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 62 - 126
Target Start/End: Original strand, 9758296 - 9758361
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggag |
126 |
Q |
| |
|
||||||||||| ||| ||||||||| ||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
9758296 |
tattgggaaaagttcatatcccacatcggatagataagactcttgataagagtttatatagaggag |
9758361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 12016708 - 12016671
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacat |
38 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
12016708 |
ggttttgtaaggatgagttaggcccccaatttcaacat |
12016671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 25753630 - 25753593
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacat |
38 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
25753630 |
ggttttgtaaggatgagttaggtcccaaatttcaacat |
25753593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 62 - 103
Target Start/End: Original strand, 33629596 - 33629637
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactc |
103 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||| |||||| |
|
|
| T |
33629596 |
tattgggaaaaacccaagtcccacatcggatagatgagactc |
33629637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 62 - 107
Target Start/End: Original strand, 39110709 - 39110754
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||| ||||||||||||| |||||| ||||||||||| |||||| |
|
|
| T |
39110709 |
tattggaaaaaactcaagtctcacatcggatagataagaatcttga |
39110754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 43943752 - 43943789
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacat |
38 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
43943752 |
ggttttgtaaggatgagttaggcccccaatttcaacat |
43943789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 991283 - 991319
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
991283 |
ggttttgtaaggatgagttagaccccaaatttcaaca |
991319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 62 - 102
Target Start/End: Original strand, 3047474 - 3047514
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagact |
102 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
3047474 |
tattgggaaaaactcaagtcttacatcagataaataagact |
3047514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 51 - 107
Target Start/End: Complemental strand, 4905628 - 4905572
Alignment:
| Q |
51 |
tgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
||||||| ||||||| || ||||| ||||||||| || |||||||||||||||||| |
|
|
| T |
4905628 |
tgaggggggtgtattcggtaaaacgtaagtcccacgtcggatagataagactcttga |
4905572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 8559996 - 8559960
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
8559996 |
ggttttgtaaggatgagttagaccccaaatttcaaca |
8559960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 13254462 - 13254498
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
13254462 |
ggttttgtaagcatgagttaggccccaaatttcaaca |
13254498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 15665232 - 15665268
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
15665232 |
ggttttgtaaggatgagttaggcctcaaatttcaaca |
15665268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 17076965 - 17076929
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
17076965 |
ggttttgtaaggttgagttaggccccaaatttcaaca |
17076929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 17222692 - 17222656
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |
|
|
| T |
17222692 |
ggttttgtaaggatgtgttaggccccaaatttcaaca |
17222656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 29734640 - 29734676
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||| |
|
|
| T |
29734640 |
ggttttgtaaggatgagttgggccccaaatttcaaca |
29734676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 34206018 - 34205982
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
34206018 |
ggttttgtaaggatgagttaggtcccaaatttcaaca |
34205982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 35399282 - 35399246
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
35399282 |
ggttttgtaaggttgagttaggccccaaatttcaaca |
35399246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 54210456 - 54210492
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
54210456 |
ggttttgtaaggatgagttaggccccaaattacaaca |
54210492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 48; Significance: 2e-18; HSPs: 85)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 48 - 134
Target Start/End: Complemental strand, 48230 - 48143
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||| |||||| ||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
48230 |
gcgtgaggggggtgtattgggaaaaacccaagtcccacatcggatagacaagactcttgagaagagtttataaagaggaggcaatcct |
48143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 48 - 107
Target Start/End: Complemental strand, 43490382 - 43490323
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
43490382 |
gcgtgaggggggtgtattgggaaaaacccaagtcccacatcggatagataagactcttga |
43490323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 48 - 107
Target Start/End: Original strand, 34457281 - 34457340
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||| |||||| ||||||||||| |
|
|
| T |
34457281 |
gcgtgaggggggtgtattgggaaaaacccaagtcccacatcggatagacaagactcttga |
34457340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 48 - 107
Target Start/End: Complemental strand, 37781970 - 37781911
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||||||| || |||||||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
37781970 |
gcgtgaggggggtatattgggaaaaactcaagtctcacatcggatagataagactcttga |
37781911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 62 - 108
Target Start/End: Complemental strand, 20720662 - 20720616
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
20720662 |
tattgggaaaaactcaagtcccacatcagatagataagattcttgat |
20720616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 62 - 134
Target Start/End: Original strand, 13413576 - 13413649
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
13413576 |
tattgggaaaaacccaagtcccacatcaaatagataagactcttgagaagagtttataaagaggaggcaatcct |
13413649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 59 - 108
Target Start/End: Complemental strand, 18107593 - 18107544
Alignment:
| Q |
59 |
gtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
18107593 |
gtgtattgggaaaaacccaagtcccacatcggatagataagactcttgat |
18107544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 48 - 108
Target Start/End: Original strand, 39268205 - 39268264
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||| ||||||||| ||||||||| |
|
|
| T |
39268205 |
gcgtgagggg-gtgtattgggaaaaacccaagtcccacatcggatagataaaactcttgat |
39268264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 48 - 107
Target Start/End: Complemental strand, 2908688 - 2908629
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
||||||| || |||||||||||||||| ||||||||||||| |||||| ||||||||||| |
|
|
| T |
2908688 |
gcgtgagaggggtgtattgggaaaaacccaagtcccacatcggatagacaagactcttga |
2908629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 2908794 - 2908751
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2908794 |
ggttttgtaaggatgagttaggccccaaatttcaacatggtatc |
2908751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 3762985 - 3763028
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3762985 |
ggttttgtaaggatgagttaggccccaaatttcaacatggtatc |
3763028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 13413663 - 13413706
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
13413663 |
ggttttgtaaggatgagttaggccccaaatttcaacatggtatc |
13413706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 13843776 - 13843819
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
13843776 |
ggttttgtaaggatgagttaggccccaaatttcaacatggtatc |
13843819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 48 - 107
Target Start/End: Complemental strand, 18914287 - 18914228
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||| ||||| ||||||||||| |
|
|
| T |
18914287 |
gcgtgaggggggtgtattgggaaaaacccaagtcccacatcggatagtcaagactcttga |
18914228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 34457175 - 34457218
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34457175 |
ggttttgtaaggatgagttaggccccaaatttcaacatggtatc |
34457218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 48 - 107
Target Start/End: Complemental strand, 37656857 - 37656799
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
37656857 |
gcgtgagggg-gtgtattggaaaaaactcaagtctcacatcggatagataagactcttga |
37656799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 40169066 - 40169023
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40169066 |
ggttttgtaaggatgagttaggccccaaatttcaacatggtatc |
40169023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 62 - 108
Target Start/End: Original strand, 39268010 - 39268056
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
39268010 |
tattgggaaaaacccaagtcccacatcggatagataagactcttgat |
39268056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 62 - 134
Target Start/End: Complemental strand, 4563803 - 4563730
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||||||||||||| ||| |||||| ||||||||||||| ||||| ||||||| ||||||||| ||||||| |
|
|
| T |
4563803 |
tattgggaaaaactcatgtctcacatcggatagataagacttttgataagagtttacatagaggagacaatcct |
4563730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 62 - 134
Target Start/End: Original strand, 29008064 - 29008137
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||||||||| || || ||||||| ||||||||||||||||||| ||||||| |||||| |||||||||| |
|
|
| T |
29008064 |
tattgggaaaaacccatgttccacatcggatagataagactcttgataggagtttatatagagaaggcaatcct |
29008137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 62 - 107
Target Start/End: Original strand, 38376723 - 38376768
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
38376723 |
tattgggaaaaacccaagtcccacatcggatagataagactcttga |
38376768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 48 - 108
Target Start/End: Complemental strand, 3015542 - 3015483
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
|||||||||| |||||||||||||||| |||| |||||||| ||||||| ||||||||||| |
|
|
| T |
3015542 |
gcgtgagggg-gtgtattgggaaaaacccaagccccacatcggatagatgagactcttgat |
3015483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 63 - 134
Target Start/End: Complemental strand, 18873305 - 18873233
Alignment:
| Q |
63 |
attgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||||||| | || |||||||||| ||||||||||||| ||||| ||||||| ||||||||||||||||| |
|
|
| T |
18873305 |
attgggaaaagcccatgtcccacatcggatagataagactattgataagagtttatatagaggaggcaatcct |
18873233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 62 - 134
Target Start/End: Complemental strand, 36308034 - 36307962
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgatcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||| ||||| |||||| ||||||| |||||||||||||||||| ||||||| | ||||||| ||||||| |
|
|
| T |
36308034 |
tattggaaaaaattcaagttccacatcggatagataagactcttgaaagagtttataaagaggagtcaatcct |
36307962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 48336 - 48293
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
48336 |
ggttttgtaaggatgagttaggcccccaatttcaacatggtatc |
48293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 62 - 132
Target Start/End: Original strand, 3762898 - 3762969
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatc |
132 |
Q |
| |
|
||||||||||||| || |||||||||| |||||||||||||||||| ||||||| | ||||||||||||| |
|
|
| T |
3762898 |
tattgggaaaaacccatgtcccacatcggatagataagactcttgagaagagtttataaagaggaggcaatc |
3762969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 4465210 - 4465167
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
4465210 |
ggttttgtaaggatgagttaagccccaaatttcaacatggtatc |
4465167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 60 - 103
Target Start/End: Original strand, 13413780 - 13413823
Alignment:
| Q |
60 |
tgtattgggaaaaactcaagtcccacatcagatagataagactc |
103 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
13413780 |
tgtattgggaaaaacccaagtcccacatcggatagataagactc |
13413823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 18914393 - 18914350
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
18914393 |
ggttttgtaagaatgagttaggccccaaatttcaacatggtatc |
18914350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 24125141 - 24125184
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
24125141 |
ggttttgtaaggatgagttagaccccaaatttcaacatggtatc |
24125184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 28156109 - 28156152
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
28156109 |
ggttttgtaaggatgaattaggccccaaatttcaacatgatatc |
28156152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 28358060 - 28358017
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
28358060 |
ggttttgtaaggatgagttaggccccaaatttcaaaatggtatc |
28358017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 64 - 134
Target Start/End: Original strand, 30330643 - 30330714
Alignment:
| Q |
64 |
ttgggaaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||||| | | ||||||| ||||||||||||||||| |
|
|
| T |
30330643 |
ttgggaaaaatccaagtcccacatcggatagataagactctgaattagagtttatatagaggaggcaatcct |
30330714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 38376810 - 38376853
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
38376810 |
ggttttgtaaggatgagttaggccccaaattacaacatggtatc |
38376853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 68 - 107
Target Start/End: Complemental strand, 40169147 - 40169108
Alignment:
| Q |
68 |
gaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40169147 |
gaaaaacccaagtcccacatcagatagataagactcttga |
40169108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 43490488 - 43490445
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
43490488 |
ggttttgtaaggatgagttaggcccccaatttcaacatggtatc |
43490445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 62 - 107
Target Start/End: Complemental strand, 10516380 - 10516334
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagat-aagactcttga |
107 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
10516380 |
tattgggaaaaactcaagtcccacatcggatagataaagactcttga |
10516334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 62 - 108
Target Start/End: Original strand, 10668352 - 10668398
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||| ||||||||| |
|
|
| T |
10668352 |
tattgggaaaaacccaagtcccacatcaaatagataaaactcttgat |
10668398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 61 - 107
Target Start/End: Complemental strand, 28358148 - 28358102
Alignment:
| Q |
61 |
gtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||| ||||||||||| |
|
|
| T |
28358148 |
gtattgggaaaaacccaagtcccacatcggatagacaagactcttga |
28358102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 62 - 108
Target Start/End: Original strand, 36878318 - 36878364
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
36878318 |
tattgggaaaaaccaaagtcccacatcagatagataagacttttgat |
36878364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 12965271 - 12965234
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacat |
38 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12965271 |
ggttttgtaaggatgagttaggccccaaatttcaacat |
12965234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 2 - 43
Target Start/End: Original strand, 30588133 - 30588174
Alignment:
| Q |
2 |
gttttgtaaggatgatttaggccccaaatttcaacatggtat |
43 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
30588133 |
gttttgtaaggatgagttaggccccaaatttctacatggtat |
30588174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 70 - 134
Target Start/End: Complemental strand, 35527092 - 35527027
Alignment:
| Q |
70 |
aaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
35527092 |
aaaacccaagtcccacatcggatagataagactcttgagaagagtttataaagaggaggcaatcct |
35527027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 3 - 44
Target Start/End: Original strand, 36878407 - 36878448
Alignment:
| Q |
3 |
ttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
36878407 |
ttttgtaaggatgatttaggcttcaaatttcaacatggtatc |
36878448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 38131843 - 38131880
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacat |
38 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38131843 |
ggttttgtaaggatgagttaggccccaaatttcaacat |
38131880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 40168884 - 40168847
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacat |
38 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40168884 |
ggttttgtaaggatgagttaggccccaaatttcaacat |
40168847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 62 - 107
Target Start/End: Complemental strand, 43490575 - 43490530
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||| ||||||||||| |
|
|
| T |
43490575 |
tattgggaaaaacccaagtcccacatcggatagacaagactcttga |
43490530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 873721 - 873685
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
873721 |
ggttttgtaaggatgagttaggccccaaatttcaaca |
873685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 64 - 108
Target Start/End: Complemental strand, 3015731 - 3015687
Alignment:
| Q |
64 |
ttgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||| ||||||||||| |
|
|
| T |
3015731 |
ttgggaaaaacccaagtcccacatcggatagatgagactcttgat |
3015687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 59 - 107
Target Start/End: Original strand, 15287042 - 15287090
Alignment:
| Q |
59 |
gtgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||||||||||||| ||||||| | ||| |||||||||||||||||| |
|
|
| T |
15287042 |
gtgtattgggaaaaacccaagtcctatatcggatagataagactcttga |
15287090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 48 - 100
Target Start/End: Complemental strand, 20720469 - 20720417
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataaga |
100 |
Q |
| |
|
|||||||||| ||||||||| ||||| ||||||||||||| ||||||||||| |
|
|
| T |
20720469 |
gcgtgaggggggtgtattggaaaaaattcaagtcccacataggatagataaga |
20720417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 24994148 - 24994184
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
24994148 |
ggttttgtaaggatgagttaggccccaaatttcaaca |
24994184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 64 - 108
Target Start/End: Original strand, 32501205 - 32501249
Alignment:
| Q |
64 |
ttgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
32501205 |
ttgggaaaaatccaagtcccacatcggatagataagactcttgat |
32501249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 34457382 - 34457418
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34457382 |
ggttttgtaaggatgagttaggccccaaatttcaaca |
34457418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 2716422 - 2716464
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
2716422 |
ggttttgtaaggatgagttaggcccc-aatttcaacatggtatc |
2716464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 3015646 - 3015603
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||| ||| |||||||| |||||||||||||||||| |
|
|
| T |
3015646 |
ggttttgtaaggttgagttaggccctaaatttcaacatggtatc |
3015603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 48 - 107
Target Start/End: Original strand, 11632410 - 11632468
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||||||| ||||||||| ||||| ||||||||||||| |||||| ||||||||||| |
|
|
| T |
11632410 |
gcgtgagggg-gtgtattggaaaaaatccaagtcccacatcggatagacaagactcttga |
11632468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 15286933 - 15286976
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||| |||||||| |
|
|
| T |
15286933 |
ggttttgtaaggatgaattagaccccaaatttcaatatggtatc |
15286976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 20720575 - 20720532
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||| |
|
|
| T |
20720575 |
ggttttgtaaggatgagttagaccccaaattttaacatggtatc |
20720532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 68 - 107
Target Start/End: Complemental strand, 35527247 - 35527208
Alignment:
| Q |
68 |
gaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
35527247 |
gaaaaacccaagtcccacatcggatagataagactcttga |
35527208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 62 - 105
Target Start/End: Complemental strand, 35527387 - 35527344
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactctt |
105 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||| |||||||||| |
|
|
| T |
35527387 |
tattgggaaaaacccaagtcccacatcggatagctaagactctt |
35527344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 50 - 108
Target Start/End: Original strand, 1893769 - 1893826
Alignment:
| Q |
50 |
gtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| || || |||||||| |||||||||| |
|
|
| T |
1893769 |
gtgagggg-gtgtattgggaaaaactcaagtctcatattggatagatacgactcttgat |
1893826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 61 - 107
Target Start/End: Complemental strand, 2908882 - 2908836
Alignment:
| Q |
61 |
gtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||| |||| |
|
|
| T |
2908882 |
gtattgggaaaaatccaagtcccacatcagatagacaagacttttga |
2908836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 70 - 108
Target Start/End: Original strand, 17135519 - 17135557
Alignment:
| Q |
70 |
aaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
17135519 |
aaaactcaagtcccacatcggataaataagactcttgat |
17135557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 62 - 108
Target Start/End: Complemental strand, 21019982 - 21019936
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
|||||||||||||||| || ||||||| |||| |||||||||||||| |
|
|
| T |
21019982 |
tattgggaaaaactcatgttccacatcggatatataagactcttgat |
21019936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 35
Target Start/End: Original strand, 24918240 - 24918274
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaa |
35 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |
|
|
| T |
24918240 |
ggttttgtaaggatgagttaggccccaaatttcaa |
24918274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 2 - 44
Target Start/End: Complemental strand, 35527202 - 35527160
Alignment:
| Q |
2 |
gttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
35527202 |
gttttgtaaggatgtgttaggccccaaattacaacatggtatc |
35527160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 3015442 - 3015405
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacat |
38 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
3015442 |
ggttttgtaaggttgagttaggccccaaatttcaacat |
3015405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 62 - 107
Target Start/End: Original strand, 15286845 - 15286890
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||||||||| |||||| |||||| |||||||||||||||||| |
|
|
| T |
15286845 |
tattgggaaaaatccaagtctcacatcggatagataagactcttga |
15286890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 2 - 35
Target Start/End: Complemental strand, 17150272 - 17150239
Alignment:
| Q |
2 |
gttttgtaaggatgatttaggccccaaatttcaa |
35 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
17150272 |
gttttgtaaggatgaattaggccccaaatttcaa |
17150239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 59 - 108
Target Start/End: Original strand, 18107822 - 18107871
Alignment:
| Q |
59 |
gtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
|||||||||||||||| ||| ||||||||| || ||||||||||||||| |
|
|
| T |
18107822 |
gtgtattgggaaaaacccaattcccacatcgaatcgataagactcttgat |
18107871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 62 - 107
Target Start/End: Complemental strand, 18914480 - 18914435
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||| ||||||||||| |
|
|
| T |
18914480 |
tattgggaaaaacccaagtcccacatcggatagtcaagactcttga |
18914435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 62 - 103
Target Start/End: Original strand, 28156028 - 28156069
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactc |
103 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||| ||||||| |
|
|
| T |
28156028 |
tattgggaaaaacccaagtcccacatcggatagacaagactc |
28156069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 38663326 - 38663363
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacat |
38 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
38663326 |
ggttttgtaaggatgagttaggccccaaatttctacat |
38663363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 59 - 99
Target Start/End: Original strand, 3763089 - 3763129
Alignment:
| Q |
59 |
gtgtattgggaaaaactcaagtcccacatcagatagataag |
99 |
Q |
| |
|
|||||||||||||||| || |||||||||| |||||||||| |
|
|
| T |
3763089 |
gtgtattgggaaaaacccatgtcccacatcggatagataag |
3763129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 11632510 - 11632546
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||| |
|
|
| T |
11632510 |
ggttttgtaaggatgagttgggccccaaatttcaaca |
11632546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 13844092 - 13844128
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
13844092 |
ggttttgtaaggatgagttaggccctaaatttcaaca |
13844128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 59 - 95
Target Start/End: Complemental strand, 17130099 - 17130063
Alignment:
| Q |
59 |
gtgtattgggaaaaactcaagtcccacatcagataga |
95 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
17130099 |
gtgtattgggaaaaacccaagtcccacatcggataga |
17130063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 18914186 - 18914150
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
18914186 |
ggttttgtaagaatgagttaggccccaaatttcaaca |
18914150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 27760454 - 27760490
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
27760454 |
ggttttgtaaggatgagttagaccccaaatttcaaca |
27760490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 59 - 107
Target Start/End: Original strand, 30592418 - 30592465
Alignment:
| Q |
59 |
gtgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||||||||||| | |||||| |||||| |||||||||||||||||| |
|
|
| T |
30592418 |
gtgtattgggaaaatc-caagtctcacatcggatagataagactcttga |
30592465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 35527013 - 35526977
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
35527013 |
ggttttgtaaggatgagttaggccccaaattacaaca |
35526977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 35527299 - 35527263
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
35527299 |
ggttttgtaaggatgagttaggccccaaattacaaca |
35527263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 4 - 44
Target Start/End: Complemental strand, 36307945 - 36307905
Alignment:
| Q |
4 |
tttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
||||||||||||| ||| ||| ||||||||||||||||||| |
|
|
| T |
36307945 |
tttgtaaggatgagttaagcctcaaatttcaacatggtatc |
36307905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 8 - 44
Target Start/End: Original strand, 39268108 - 39268144
Alignment:
| Q |
8 |
taaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
39268108 |
taaggatgagttaggcctcaaatttcaacatggtatc |
39268144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 48; Significance: 2e-18; HSPs: 89)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 48 - 134
Target Start/End: Complemental strand, 39649003 - 39648917
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||| |||||||||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
39649003 |
gcgtgaggggggtgtattgggaaaaacccaagtcccacatc-gatagataagactcttgagaagagtttataaagaggaggcaatcct |
39648917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 48 - 107
Target Start/End: Original strand, 15392004 - 15392062
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
15392004 |
gcgtgagggg-gtgtattgggaaaaacccaagtcccacatcggatagataagactcttga |
15392062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 48 - 107
Target Start/End: Complemental strand, 24382277 - 24382218
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||| |||||||||||||||||| | ||||||||||||| |||||||||||||||||| |
|
|
| T |
24382277 |
gcgtgacgggagtgtattgggaaaatcccaagtcccacatcggatagataagactcttga |
24382218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 62 - 108
Target Start/End: Complemental strand, 38871267 - 38871221
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38871267 |
tattgggaaaaacccaagtcccacatcagatagataagactcttgat |
38871221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 61 - 134
Target Start/End: Complemental strand, 39649197 - 39649123
Alignment:
| Q |
61 |
gtattgggaaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
39649197 |
gtattgggaaaaacccaagtcccacatcggatagataagactcttgagaagagtttataaagaggaggcaatcct |
39649123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 50 - 134
Target Start/End: Complemental strand, 803591 - 803506
Alignment:
| Q |
50 |
gtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttgatcg-agtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||| ||||||||||||| ||||||||| ||||||||||||||| |||||| |||| || | |||||| ||||||||| ||||||| |
|
|
| T |
803591 |
gtgacgggagtgtattggaaaaaactcatgtcccacatcagatatataagattcttaatagaagtttatatagaggagacaatcct |
803506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 59 - 108
Target Start/End: Original strand, 47377824 - 47377873
Alignment:
| Q |
59 |
gtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
47377824 |
gtgtattgggaaaaactcatgtcccacatcggatagataagactcttgat |
47377873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 49 - 108
Target Start/End: Complemental strand, 38871075 - 38871015
Alignment:
| Q |
49 |
cgtgaggggagtgtattgggaaaaactc-aagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
||||||||| |||||||||||||||| | |||||||||||||||| ||||||||||||||| |
|
|
| T |
38871075 |
cgtgaggggggtgtattgggaaaaaccccaagtcccacatcagatcgataagactcttgat |
38871015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 60 - 108
Target Start/End: Complemental strand, 42845135 - 42845087
Alignment:
| Q |
60 |
tgtattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
42845135 |
tgtattaggaaaaactcaagtaccacatcagatagataagactcttgat |
42845087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 48 - 107
Target Start/End: Complemental strand, 5325052 - 5324993
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||||||| |||| |||||||| |||| |
|
|
| T |
5325052 |
gcgtgaggggggtgtattgggaaaaattcaagtcccacatcggataaataagacttttga |
5324993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 9380979 - 9381022
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9380979 |
ggttttgtaaggatgagttaggccccaaatttcaacatggtatc |
9381022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 48 - 107
Target Start/End: Original strand, 12314556 - 12314615
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||||||||| |||||| ||||||||||| |
|
|
| T |
12314556 |
gcgtgaggggggtgtattgggaaaaatccaagtcccacatcggatagacaagactcttga |
12314615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 20735601 - 20735644
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
20735601 |
ggttttgtaaggatgagttaggccccaaatttcaacatggtatc |
20735644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 21538959 - 21538916
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
21538959 |
ggttttgtaaggatgatttaggccccaaatttctacatggtatc |
21538916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 29273091 - 29273048
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
29273091 |
ggttttgtaaggatgagttaggccccaaatttcaacatggtatc |
29273048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 29273250 - 29273207
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
29273250 |
ggttttgtaaggatgagttaggccccaaatttcaacatggtatc |
29273207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 2 - 44
Target Start/End: Original strand, 25799264 - 25799306
Alignment:
| Q |
2 |
gttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
25799264 |
gttttgtaaggatgagttaggccccaaatttcaacatggtatc |
25799306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 49 - 134
Target Start/End: Original strand, 29413327 - 29413413
Alignment:
| Q |
49 |
cgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||| || || | ||||||||||||||||| ||||||| | |||||||||| |||| |
|
|
| T |
29413327 |
cgtgaggggggtgtattgggaaaaacccaagtcctacttcgggtagataagactcttgataagagtttataaagaggaggcactcct |
29413413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 62 - 108
Target Start/End: Original strand, 45395544 - 45395590
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
45395544 |
tattgggaaaaacccaagtcccatatcagatagataagactcttgat |
45395590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 62 - 134
Target Start/End: Original strand, 5222686 - 5222759
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||||||||||| ||||||| |||||||| ||||||| |
|
|
| T |
5222686 |
tattgggaaaaacctaagtcccacatctgatagataagactcttgataagagtttatgtagaggagacaatcct |
5222759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 70 - 134
Target Start/End: Complemental strand, 6238441 - 6238376
Alignment:
| Q |
70 |
aaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||| || ||||||||||||||||||||||||| |||| ||||||| ||||||||||||||||| |
|
|
| T |
6238441 |
aaaacacatgtcccacatcagatagataagactcctgataagagtttatatagaggaggcaatcct |
6238376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 48 - 108
Target Start/End: Original strand, 49895331 - 49895389
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| || ||||||||||| ||||||||||| |
|
|
| T |
49895331 |
gcgtgaggggagtgtattggaaaaaactcaagt--catatcagatagatgagactcttgat |
49895389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 62 - 107
Target Start/End: Complemental strand, 52846961 - 52846916
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
52846961 |
tattgggaaaaacccaagtcccacatcggatagataagactcttga |
52846916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 4 - 44
Target Start/End: Original strand, 9381181 - 9381221
Alignment:
| Q |
4 |
tttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9381181 |
tttgtaaggatgagttaggccccaaatttcaacatggtatc |
9381221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 48 - 108
Target Start/End: Complemental strand, 47086403 - 47086343
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
|||||| ||| ||||||||| ||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
47086403 |
gcgtgacgggggtgtattggaaaaaatccatgtcccacatcagatagataagactcttgat |
47086343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 19481417 - 19481378
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatgg |
40 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19481417 |
ggttttgtaaggatgagttaggccccaaatttcaacatgg |
19481378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 61 - 134
Target Start/End: Complemental strand, 22826859 - 22826784
Alignment:
| Q |
61 |
gtattgggaaaaa-ctcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||||||||| | || |||||||||| ||||||||||||||||||| ||||||| ||||||||| ||||||| |
|
|
| T |
22826859 |
gtattgggaaaaaacccatgtcccacatcggatagataagactcttgataagagtttatatagaggagacaatcct |
22826784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 48 - 134
Target Start/End: Complemental strand, 43361676 - 43361591
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||||||| |||||||||||||| | ||||||||||||| |||||| ||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
43361676 |
gcgtgagggg-gtgtattgggaaaacc-caagtcccacatcggatagacaagactcttgagaagagtttataaagaggaggcaatcct |
43361591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 48 - 107
Target Start/End: Original strand, 46098662 - 46098720
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||| |||| |||||||||||| |||||||| |
|
|
| T |
46098662 |
gcgtgagggg-gtgtattggaaaaaactcaagttccacgtcagatagataaaactcttga |
46098720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 2997286 - 2997244
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtat |
43 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
2997286 |
ggttttgtaaagatgagttaggccccaaatttcaacatggtat |
2997244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 62 - 108
Target Start/End: Original strand, 11581747 - 11581793
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
|||||| |||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
11581747 |
tattggaaaaaactcaaatcccacatcggatagataagactcttgat |
11581793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 2 - 44
Target Start/End: Original strand, 15391899 - 15391941
Alignment:
| Q |
2 |
gttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
15391899 |
gttttgtaaggatgagtaaggccccaaatttcaacatggtatc |
15391941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 62 - 107
Target Start/End: Complemental strand, 2997373 - 2997328
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||| |||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
2997373 |
tattaggaaaaactcaaatcccacatcggatagataagactcttga |
2997328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 48 - 105
Target Start/End: Complemental strand, 3774191 - 3774134
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactctt |
105 |
Q |
| |
|
|||||||||| |||||||| ||||| ||||||| ||||||| ||||||||||| |||| |
|
|
| T |
3774191 |
gcgtgaggggggtgtattgagaaaagctcaagttccacatcggatagataagattctt |
3774134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 62 - 107
Target Start/End: Original strand, 9380892 - 9380937
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||| ||||||||||| |
|
|
| T |
9380892 |
tattgggaaaaacccaagtcccacatcggatagacaagactcttga |
9380937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 62 - 107
Target Start/End: Original strand, 11018846 - 11018891
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
11018846 |
tattgggaaaaattcaagtcccacatcagataactaagactcttga |
11018891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 59 - 108
Target Start/End: Complemental strand, 21428173 - 21428124
Alignment:
| Q |
59 |
gtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
||||||||||||||| |||||||| |||| ||||||||||||||||||| |
|
|
| T |
21428173 |
gtgtattgggaaaaattcaagtcctacattggatagataagactcttgat |
21428124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 59 - 96
Target Start/End: Complemental strand, 22892536 - 22892499
Alignment:
| Q |
59 |
gtgtattgggaaaaactcaagtcccacatcagatagat |
96 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
22892536 |
gtgtattgggaaaaacccaagtcccacatcagatagat |
22892499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 59 - 108
Target Start/End: Complemental strand, 22892803 - 22892754
Alignment:
| Q |
59 |
gtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||| || ||||||||||| |
|
|
| T |
22892803 |
gtgtattgggaaaaacccaagtcccacatcaaataaatgagactcttgat |
22892754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 48 - 105
Target Start/End: Complemental strand, 24382693 - 24382637
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactctt |
105 |
Q |
| |
|
||||||||||| ||||||| |||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
24382693 |
gcgtgagggga-tgtattgagaaaaaaccaagtcccacatcggatagataagactctt |
24382637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 62 - 107
Target Start/End: Original strand, 25799112 - 25799157
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||| |||||||| |
|
|
| T |
25799112 |
tattgggaaaaacccatgtcccacatcagatagataaaactcttga |
25799157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 62 - 107
Target Start/End: Original strand, 29265910 - 29265955
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
||||||||||||| ||||||||||||| ||| |||||||||||||| |
|
|
| T |
29265910 |
tattgggaaaaacccaagtcccacatcggatggataagactcttga |
29265955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 62 - 107
Target Start/End: Complemental strand, 29273337 - 29273292
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||| ||||||||||| |
|
|
| T |
29273337 |
tattgggaaaaacccaagtcccacatcggatagacaagactcttga |
29273292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 62 - 107
Target Start/End: Original strand, 39648827 - 39648872
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
||||||||||| | ||||||||||||| |||||||||||||||||| |
|
|
| T |
39648827 |
tattgggaaaatcccaagtcccacatcggatagataagactcttga |
39648872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 62 - 107
Target Start/End: Complemental strand, 48558433 - 48558388
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
||||||||||||| ||||||||| ||| |||||||||||||||||| |
|
|
| T |
48558433 |
tattgggaaaaacccaagtcccatatcggatagataagactcttga |
48558388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 2997081 - 2997045
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2997081 |
ggttttgtaaggatgagttaggccccaaatttcaaca |
2997045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 59 - 107
Target Start/End: Complemental strand, 2997171 - 2997123
Alignment:
| Q |
59 |
gtgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||| |||||||| |
|
|
| T |
2997171 |
gtgtattgggaaaaacctaagtcccacatcggatagataaaactcttga |
2997123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 21638291 - 21638255
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
21638291 |
ggttttgtaaggatgagttaggccccaaatttcaaca |
21638255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 33879803 - 33879767
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33879803 |
ggttttgtaaggatgagttaggccccaaatttcaaca |
33879767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 33964452 - 33964488
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33964452 |
ggttttgtaaggatgagttaggccccaaatttcaaca |
33964488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 35926273 - 35926237
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35926273 |
ggttttgtaaggatgagttaggccccaaatttcaaca |
35926237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 64 - 108
Target Start/End: Original strand, 49828665 - 49828709
Alignment:
| Q |
64 |
ttgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||| |||||||||| |
|
|
| T |
49828665 |
ttgggaaaaacccaagtcccacatctgatagataggactcttgat |
49828709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 2 - 37
Target Start/End: Complemental strand, 4022149 - 4022114
Alignment:
| Q |
2 |
gttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4022149 |
gttttgtaaggatgagttaggccccaaatttcaaca |
4022114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 12314450 - 12314493
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
12314450 |
ggttttgtaaggatgagttaggccctgaatttcaacatggtatc |
12314493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 15392104 - 15392139
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaac |
36 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
15392104 |
ggttttgtaaggatgagttaggccccaaatttcaac |
15392139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 24382385 - 24382342
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||| | ||||| ||||||||||||||||||||||||||| |
|
|
| T |
24382385 |
ggttttgtgatgatgaattaggccccaaatttcaacatggtatc |
24382342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 38871180 - 38871137
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
38871180 |
ggttttgtaaggatgcgttaggcctcaaatttcaacatggtatc |
38871137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 61 - 108
Target Start/End: Original strand, 45982173 - 45982220
Alignment:
| Q |
61 |
gtattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
|||||||||||||| ||||||| || |||||||||||| ||||||||| |
|
|
| T |
45982173 |
gtattgggaaaaacccaagtccaacgtcagatagataaaactcttgat |
45982220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 46098556 - 46098599
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
||||||| |||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
46098556 |
ggttttgcaaggatgagttaggccccaaattttaacatggtatc |
46098599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 59 - 102
Target Start/End: Original strand, 49142671 - 49142714
Alignment:
| Q |
59 |
gtgtattgggaaaaactcaagtcccacatcagatagataagact |
102 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
49142671 |
gtgtattgggaaaaacccaagtcccacattggatagataagact |
49142714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 62 - 108
Target Start/End: Original strand, 1233918 - 1233964
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
|||||| |||||| ||||||||||||| ||||||| ||||||||||| |
|
|
| T |
1233918 |
tattggtaaaaacccaagtcccacatcggatagatgagactcttgat |
1233964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 3 - 37
Target Start/End: Original strand, 15392185 - 15392219
Alignment:
| Q |
3 |
ttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
15392185 |
ttttgtaaggatgagttaggccccaaatttcaaca |
15392219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 5 - 43
Target Start/End: Complemental strand, 21428288 - 21428250
Alignment:
| Q |
5 |
ttgtaaggatgatttaggccccaaatttcaacatggtat |
43 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
21428288 |
ttgtgaggatgagttaggccccaaatttcaacatggtat |
21428250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 22892458 - 22892424
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaa |
35 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |
|
|
| T |
22892458 |
ggttttgtaaggatgagttaggccccaaatttcaa |
22892424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 49 - 134
Target Start/End: Complemental strand, 24382484 - 24382399
Alignment:
| Q |
49 |
cgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||||| |||||||||||||||| ||| ||| ||||| |||| || ||||||||||| ||||||| | |||||||||| |||| |
|
|
| T |
24382484 |
cgtgagggg-gtgtattgggaaaaacccaaatccaacatcggataaatgagactcttgatgagagtttataaagaggaggcactcct |
24382399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 2 - 44
Target Start/End: Complemental strand, 24382800 - 24382758
Alignment:
| Q |
2 |
gttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
||||||| ||||||| || |||||||||||||||||||||||| |
|
|
| T |
24382800 |
gttttgtgaggatgagtttggccccaaatttcaacatggtatc |
24382758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 29272932 - 29272894
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatg |
39 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
29272932 |
ggttttgtaaggatgagttaggcctcaaatttcaacatg |
29272894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 62 - 96
Target Start/End: Original strand, 49895145 - 49895179
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagat |
96 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
49895145 |
tattgggaaaaactcaagtctcacatcagatagat |
49895179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 482762 - 482799
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacat |
38 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
482762 |
ggttttttaaggatgagttaggccccaaatttcaacat |
482799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 62 - 107
Target Start/End: Original strand, 13959394 - 13959439
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
||||||||| ||| |||||| |||||| |||||||||||||||||| |
|
|
| T |
13959394 |
tattgggaataacgcaagtctcacatcggatagataagactcttga |
13959439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 17419866 - 17419903
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacat |
38 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
17419866 |
ggttttgtaaggatgagttagaccccaaatttcaacat |
17419903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 78 - 134
Target Start/End: Original strand, 20735763 - 20735820
Alignment:
| Q |
78 |
agtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||||||||||||||||||||||| || | ||||||| | |||||||||| |||| |
|
|
| T |
20735763 |
agtcccacatcagatagataagactctcgagtagagtttataaagaggaggcactcct |
20735820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 22892713 - 22892680
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttca |
34 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
22892713 |
ggttttgtaaggatgagttaggccccaaatttca |
22892680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 70 - 107
Target Start/End: Complemental strand, 33342382 - 33342345
Alignment:
| Q |
70 |
aaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
33342382 |
aaaacccaagtcccacatcagatagatgagactcttga |
33342345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 59 - 108
Target Start/End: Original strand, 36332300 - 36332349
Alignment:
| Q |
59 |
gtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||| ||||||||| |
|
|
| T |
36332300 |
gtgtattgggaaaaacgcaagtcccacattggatagatagaactcttgat |
36332349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 39649109 - 39649072
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacat |
38 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
39649109 |
ggttttgtaaggatgagttatgccccaaatttcaacat |
39649072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 40367664 - 40367709
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggcccc-aaatttcaacatggtatct |
45 |
Q |
| |
|
|||||||||||||||| ||| ||||| ||||||||||||||||||| |
|
|
| T |
40367664 |
ggttttgtaaggatgagttatgccccaaaatttcaacatggtatct |
40367709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 48 - 105
Target Start/End: Complemental strand, 42844941 - 42844884
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactctt |
105 |
Q |
| |
|
|||||||||| |||||| | ||||| |||||||||||||| ||||||||| |||||| |
|
|
| T |
42844941 |
gcgtgagggggatgtattagaaaaaattcaagtcccacatcggatagataatactctt |
42844884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 76 - 108
Target Start/End: Complemental strand, 10017426 - 10017394
Alignment:
| Q |
76 |
caagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
10017426 |
caagtgccacatcagatagataagactcttgat |
10017394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 13959481 - 13959517
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
13959481 |
ggttttttaaggatgagttaggccccaaatttcaaca |
13959517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 2 - 42
Target Start/End: Complemental strand, 19481718 - 19481678
Alignment:
| Q |
2 |
gttttgtaaggatgatttaggccccaaatttcaacatggta |
42 |
Q |
| |
|
|||||||||||| || |||||||||| |||||||||||||| |
|
|
| T |
19481718 |
gttttgtaaggaggaattaggccccagatttcaacatggta |
19481678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 31305790 - 31305826
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
31305790 |
ggttttgtaaggatgagttaggctccaaatttcaaca |
31305826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 37600951 - 37600987
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
37600951 |
ggttttgtaaggatgagttaagccccaaatttcaaca |
37600987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 38870974 - 38870938
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
38870974 |
ggttttgtaaggatgagttaggcctcaaatttcaaca |
38870938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 45403519 - 45403555
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
45403519 |
ggttttgtaaggatgagttaggcctcaaatttcaaca |
45403555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 48558346 - 48558310
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
48558346 |
ggttttgtaaggatgagttaagccccaaatttcaaca |
48558310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 49828736 - 49828772
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
49828736 |
ggttttgtaagaatgagttaggccccaaatttcaaca |
49828772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 52846874 - 52846838
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
52846874 |
ggttttgtaaggatgagttaagccccaaatttcaaca |
52846838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 62 - 106
Target Start/End: Complemental strand, 52921579 - 52921535
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttg |
106 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||| ||||||| |
|
|
| T |
52921579 |
tattgggaaaaacccaagtcccacatcggatagatagtactcttg |
52921535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 47; Significance: 9e-18; HSPs: 74)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 61 - 134
Target Start/End: Original strand, 26394542 - 26394616
Alignment:
| Q |
61 |
gtattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||||||||||||| || ||||||| ||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
26394542 |
gtattgggaaaaactcatgttccacatcggatagataagactcttgataagagtttatatagaggaggcaatcct |
26394616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 48 - 107
Target Start/End: Complemental strand, 11313508 - 11313449
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||||||| |||||||||||||||| ||| ||||||||| |||||||||||||||||| |
|
|
| T |
11313508 |
gcgtgaggggggtgtattgggaaaaacccaaatcccacatcggatagataagactcttga |
11313449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 48 - 134
Target Start/End: Complemental strand, 15101237 - 15101150
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||||||||| |||||| ||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
15101237 |
gcgtgaggggggtgtattgggaaaaatccaagtcccacatcggatagacaagactcttgagaagagtttataaagaggaggcaatcct |
15101150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 48 - 107
Target Start/End: Complemental strand, 18494400 - 18494341
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||||||| |||||||||||||||| ||| |||||||||||||||| ||||||||||| |
|
|
| T |
18494400 |
gcgtgaggggggtgtattgggaaaaacccaaatcccacatcagatagacaagactcttga |
18494341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 48 - 106
Target Start/End: Original strand, 16590162 - 16590220
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttg |
106 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||| |||||| |||||||||| |
|
|
| T |
16590162 |
gcgtgaggggggtgtattgggaaaaacccaagtcccacatcggatagacaagactcttg |
16590220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 48 - 106
Target Start/End: Complemental strand, 16605218 - 16605160
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttg |
106 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||| |||||| |||||||||| |
|
|
| T |
16605218 |
gcgtgaggggggtgtattgggaaaaacccaagtcccacatcggatagacaagactcttg |
16605160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 3 - 44
Target Start/End: Original strand, 25998898 - 25998939
Alignment:
| Q |
3 |
ttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25998898 |
ttttgtaaggatgatttaggccccaaatttcaacatggtatc |
25998939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 48 - 108
Target Start/End: Original strand, 11317026 - 11317086
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||| ||||||| | ||||||||| |
|
|
| T |
11317026 |
gcgtgaggggggtgtattgggaaaaacccaagtcccacatcggatagatgaaactcttgat |
11317086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 60 - 134
Target Start/End: Complemental strand, 15102739 - 15102664
Alignment:
| Q |
60 |
tgtattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||| ||||||||||| ||||||| | |||||||||| |||| |
|
|
| T |
15102739 |
tgtattgggaaaaacccaagtcccacatcaaatagatgagactcttgatgagagtttataaagaggaggcactcct |
15102664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 16877035 - 16876992
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
16877035 |
ggttttgtaaggatgagttaggccccaaatttcaacatggtatc |
16876992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 21089188 - 21089145
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
21089188 |
ggttttgtaaggatgagttaggccccaaatttcaacatggtatc |
21089145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 56 - 134
Target Start/End: Original strand, 28149779 - 28149858
Alignment:
| Q |
56 |
ggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||| ||||||||||||| || |||||||||| ||||||||| ||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
28149779 |
ggagtctattgggaaaaacccatgtcccacatcggatagataaaactcttgataagagtttataaagaggaggcaatcct |
28149858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 2 - 44
Target Start/End: Complemental strand, 11313406 - 11313364
Alignment:
| Q |
2 |
gttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
11313406 |
gttttgtaaggatgagttaggccccaaatttcaacatggtatc |
11313364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 62 - 107
Target Start/End: Complemental strand, 6623537 - 6623492
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
6623537 |
tattgggaaaaacccaagtcccacatcggatagataagactcttga |
6623492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 62 - 134
Target Start/End: Complemental strand, 16877122 - 16877049
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||| ||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
16877122 |
tattgggaaaaacccaagtcccacatcggatagacaagactcttgagaagagtttataaagaggaggcaatcct |
16877049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 62 - 107
Target Start/End: Original strand, 24558575 - 24558620
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
24558575 |
tattgggaaaaatccaagtcccacatcagatagataagactcttga |
24558620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 3 - 44
Target Start/End: Original strand, 26098423 - 26098464
Alignment:
| Q |
3 |
ttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
26098423 |
ttttgtaaggatgagttaggccccaaatttcaacatggtatc |
26098464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 48 - 108
Target Start/End: Complemental strand, 2923082 - 2923022
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
|||||| ||| ||||||||||||||||||| ||||||| || |||||||| |||||||||| |
|
|
| T |
2923082 |
gcgtgacgggggtgtattgggaaaaactcatgtcccacgtcggatagatatgactcttgat |
2923022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 48 - 108
Target Start/End: Original strand, 25999002 - 25999061
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||| ||| |||||||||| |||| |
|
|
| T |
25999002 |
gcgtgagggg-gtgtattgggaaaaacccaagtcccacatcggattgataagactcatgat |
25999061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 16590263 - 16590306
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
16590263 |
ggttttgtaaggatgagttagaccccaaatttcaacatggtatc |
16590306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 16605117 - 16605074
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
16605117 |
ggttttgtaaggatgagttagaccccaaatttcaacatggtatc |
16605074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 17147930 - 17147887
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
17147930 |
ggttttgtaaggatgagttaggccacaaatttcaacatggtatc |
17147887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 19712634 - 19712591
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
19712634 |
ggttttgtaaggatgagttaggccccaaattacaacatggtatc |
19712591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 49 - 103
Target Start/End: Original strand, 5648978 - 5649032
Alignment:
| Q |
49 |
cgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactc |
103 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||| || | ||||||||||||| |
|
|
| T |
5648978 |
cgtgaggggggtgtattggggaaaactcaagtcccatataaaatagataagactc |
5649032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 62 - 108
Target Start/End: Original strand, 11316835 - 11316881
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||| ||||||||||| |
|
|
| T |
11316835 |
tattgggaaaaactcaagttccacatcggatagatgagactcttgat |
11316881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 62 - 108
Target Start/End: Original strand, 25998809 - 25998855
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||||||| |||| |
|
|
| T |
25998809 |
tattgggaaaaacccaagtcccacatcggatagataagactcatgat |
25998855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 62 - 108
Target Start/End: Original strand, 26098334 - 26098380
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||||||| |||| |
|
|
| T |
26098334 |
tattgggaaaaacccaagtcccacatcggatagataagactcatgat |
26098380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 59 - 108
Target Start/End: Complemental strand, 15102866 - 15102818
Alignment:
| Q |
59 |
gtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||| ||||||||||| |
|
|
| T |
15102866 |
gtgtattgggaaaaacccaagtcc-acatcagatagatgagactcttgat |
15102818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 3 - 44
Target Start/End: Original strand, 26098629 - 26098670
Alignment:
| Q |
3 |
ttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
26098629 |
ttttgtaagaatgagttaggccccaaatttcaacatggtatc |
26098670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 63 - 108
Target Start/End: Complemental strand, 26598908 - 26598863
Alignment:
| Q |
63 |
attgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||| ||||||||| |
|
|
| T |
26598908 |
attgggaaaaactcaagccccacataagatagataaaactcttgat |
26598863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 1744867 - 1744831
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1744867 |
ggttttgtaaggatgagttaggccccaaatttcaaca |
1744831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 60 - 108
Target Start/End: Complemental strand, 12124808 - 12124760
Alignment:
| Q |
60 |
tgtattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| ||||| ||||| |
|
|
| T |
12124808 |
tgtattgggaaaaacctaagtcccacatcagatagatgagactattgat |
12124760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 12134508 - 12134472
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
12134508 |
ggttttgtaaggatgagttaggccccaaatttcaaca |
12134472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 16876855 - 16876819
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
16876855 |
ggttttgtaaggatgagttaggccccaaatttcaaca |
16876819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 18494504 - 18494540
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
18494504 |
ggttttgtaaggatgaattaggccccaaatttcaaca |
18494540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 24055134 - 24055098
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
24055134 |
ggttttgtaaggatgagttaggccccaaatttcaaca |
24055098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 24558867 - 24558903
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
24558867 |
ggttttgtaaggatgagttaggccccaaatttcaaca |
24558903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 28149872 - 28149908
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28149872 |
ggttttgtaaggatgagttaggccccaaatttcaaca |
28149908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 48 - 134
Target Start/End: Complemental strand, 29742560 - 29742475
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||||||| ||||||| ||||||||| |||||||||||| ||| ||||||||||||| |||||| | ||||||||||||||| |
|
|
| T |
29742560 |
gcgtgaggggggtgtattaggaaaaacttaagtcccacatcggat--ttaagactcttgatgaaagtttataaagaggaggcaatcct |
29742475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 5 - 44
Target Start/End: Original strand, 8143785 - 8143824
Alignment:
| Q |
5 |
ttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
8143785 |
ttgtaaggatgagttaggccccaaatttcgacatggtatc |
8143824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 11316922 - 11316965
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||| ||| ||||||||| ||||||||||||||||| |
|
|
| T |
11316922 |
ggttttgtaaggttgagttaggcccccaatttcaacatggtatc |
11316965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 59 - 98
Target Start/End: Complemental strand, 13692283 - 13692244
Alignment:
| Q |
59 |
gtgtattgggaaaaactcaagtcccacatcagatagataa |
98 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
13692283 |
gtgtattgggaaaaactcaagtctcacatcggatagataa |
13692244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 19291943 - 19291900
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||||| |||| |
|
|
| T |
19291943 |
ggttttgtaaggatgagttaggctccaaatttcaacatgatatc |
19291900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 24558662 - 24558705
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||| |||||||| |
|
|
| T |
24558662 |
ggttttgtgaggatgagttaggccccaaatttcaagatggtatc |
24558705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 30526917 - 30526960
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||| ||| ||||||||| ||||||||||||||||| |
|
|
| T |
30526917 |
ggttttgtaaggttgagttaggcccccaatttcaacatggtatc |
30526960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 49 - 108
Target Start/End: Original strand, 30527022 - 30527080
Alignment:
| Q |
49 |
cgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
||||||||| ||||||||| || ||||||||||||||||| ||||||| | ||||||||| |
|
|
| T |
30527022 |
cgtgagggg-gtgtattggaaacaactcaagtcccacatcggatagatgaaactcttgat |
30527080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 30539314 - 30539357
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
30539314 |
ggttttgtaaggatgaactaggccccaaatttcaacatgctatc |
30539357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 65 - 108
Target Start/End: Original strand, 30539415 - 30539458
Alignment:
| Q |
65 |
tgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||| ||||| |
|
|
| T |
30539415 |
tgggaaaaacccaagtcccacatcggatagataagacttttgat |
30539458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 1469040 - 1469085
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggcccc--aaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
1469040 |
ggttttgtaaggatgagttaggccccaaaaatttcaacatggtatc |
1469085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 62 - 108
Target Start/End: Complemental strand, 15293986 - 15293940
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||| ||| ||||||| |
|
|
| T |
15293986 |
tattgggaaaaactcaagtctcgcatcagatagattagattcttgat |
15293940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 6 - 44
Target Start/End: Complemental strand, 18494501 - 18494463
Alignment:
| Q |
6 |
tgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
18494501 |
tgtaaggatgagttaggcccccaatttcaacatggtatc |
18494463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 77 - 134
Target Start/End: Complemental strand, 19292015 - 19291957
Alignment:
| Q |
77 |
aagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||| ||||||||| ||||||| |
|
|
| T |
19292015 |
aagtcccacatcggatagataagactcttgataagagtttgtatagaggagacaatcct |
19291957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 3 - 37
Target Start/End: Complemental strand, 19712427 - 19712393
Alignment:
| Q |
3 |
ttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
19712427 |
ttttgtaaggatgagttaggccccaaatttcaaca |
19712393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 19753945 - 19753903
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtat |
43 |
Q |
| |
|
|||||||||| |||||||||| |||||||| |||||||||||| |
|
|
| T |
19753945 |
ggttttgtaatgatgatttagaccccaaatctcaacatggtat |
19753903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 50 - 108
Target Start/End: Original strand, 26098735 - 26098792
Alignment:
| Q |
50 |
gtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||| ||||| ||| |||||||||| |||| |
|
|
| T |
26098735 |
gtgagggg-gtgtattgggaaaaacccaagtcctacatcggattgataagactcatgat |
26098792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 10733463 - 10733430
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttca |
34 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
10733463 |
ggttttgtaaggatgagttaggccccaaatttca |
10733430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 3 - 36
Target Start/End: Complemental strand, 12124727 - 12124694
Alignment:
| Q |
3 |
ttttgtaaggatgatttaggccccaaatttcaac |
36 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
12124727 |
ttttgtaaggatgagttaggccccaaatttcaac |
12124694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 15101136 - 15101099
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacat |
38 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
15101136 |
ggttttgtaaggatgagttaggcccccaatttcaacat |
15101099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 69 - 105
Target Start/End: Original strand, 2902819 - 2902855
Alignment:
| Q |
69 |
aaaaactcaagtcccacatcagatagataagactctt |
105 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
2902819 |
aaaaactcaagtcctacatcggatagataagactctt |
2902855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 2 - 38
Target Start/End: Original strand, 3713525 - 3713561
Alignment:
| Q |
2 |
gttttgtaaggatgatttaggccccaaatttcaacat |
38 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
3713525 |
gttttgtaaggatgagttaggccacaaatttcaacat |
3713561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 8144096 - 8144128
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttc |
33 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
8144096 |
ggttttgtaaggatgagttaggccccaaatttc |
8144128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 4 - 44
Target Start/End: Original strand, 8929927 - 8929967
Alignment:
| Q |
4 |
tttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
||||||||||||| |||| || ||||||||||||||||||| |
|
|
| T |
8929927 |
tttgtaaggatgaattagacctcaaatttcaacatggtatc |
8929967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 10418363 - 10418327
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
10418363 |
ggttttgtaaggatgagttaggccccaaattccaaca |
10418327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 15102649 - 15102613
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
15102649 |
ggttttgtaaggatgagttagaccccaaatttcaaca |
15102613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 15102971 - 15102931
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggt |
41 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||||||||| |
|
|
| T |
15102971 |
ggttttgtaaggatgagttagaccacaaatttcaacatggt |
15102931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 17096723 - 17096687
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
17096723 |
ggttttgtaaggatgagttagaccccaaatttcaaca |
17096687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 19054572 - 19054608
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
19054572 |
ggttttgtaaggatgagttagtccccaaatttcaaca |
19054608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 59 - 107
Target Start/End: Complemental strand, 19712519 - 19712471
Alignment:
| Q |
59 |
gtgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
||||||||||||||| || || ||||||| |||||||||||||||||| |
|
|
| T |
19712519 |
gtgtattgggaaaaatccatgttccacatcggatagataagactcttga |
19712471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 62 - 133
Target Start/End: Complemental strand, 21110084 - 21110012
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttgat-cgagtttagatagaggaggcaatcc |
133 |
Q |
| |
|
||||||||||| | || ||||||| || ||||||||||| ||||| | ||||||| |||||||||||||||| |
|
|
| T |
21110084 |
tattgggaaaatcccatgtcccacgtcggatagataagattcttggtaagagtttatatagaggaggcaatcc |
21110012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 25999102 - 25999138
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
25999102 |
ggttttgtaagaatgagttaggccccaaatttcaaca |
25999138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 48 - 88
Target Start/End: Original strand, 26098527 - 26098566
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatc |
88 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
26098527 |
gcgtgagggg-gtgtattgggaaaaacccaagtcccacatc |
26098566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 26098833 - 26098869
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
26098833 |
ggttttgtaagaatgagttaggccccaaatttcaaca |
26098869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 27914351 - 27914319
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttc |
33 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
27914351 |
ggttttgtaaggatgagttaggccccaaatttc |
27914319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 30539499 - 30539535
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30539499 |
ggttttgtaaggatgggttaggccccaaatttcaaca |
30539535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0434 (Bit Score: 44; Significance: 6e-16; HSPs: 3)
Name: scaffold0434
Description:
Target: scaffold0434; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 48 - 134
Target Start/End: Original strand, 13491 - 13578
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||| ||| |||||| ||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
13491 |
gcgtgaggggggtgtattgggaaaaacccaagtcccaaatcggatagacaagactcttgagaagagtttataaagaggaggcaatcct |
13578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0434; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 62 - 134
Target Start/End: Original strand, 13298 - 13371
Alignment:
| Q |
62 |
tattgggaaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||| ||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
13298 |
tattgggaaaaactcaggtcccacatcggatagacaagactcttgagaagagtttataaagaggaggcaatcct |
13371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0434; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 13385 - 13428
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaacatggtatc |
44 |
Q |
| |
|
|||||||| ||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
13385 |
ggttttgtgaggatgagttaggccccgaatttcaacatggtatc |
13428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0989 (Bit Score: 37; Significance: 0.000000000008; HSPs: 2)
Name: scaffold0989
Description:
Target: scaffold0989; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 63 - 134
Target Start/End: Complemental strand, 3058 - 2986
Alignment:
| Q |
63 |
attgggaaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||| ||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
3058 |
attgggaaaaacccaagtcccacatcggatagacaagactcttgagaagagtttataaagaggaggcaatcct |
2986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0989; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 2972 - 2936
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2972 |
ggttttgtaaggatgagttaggccccaaatttcaaca |
2936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0029 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0029
Description:
Target: scaffold0029; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 69 - 134
Target Start/End: Original strand, 76851 - 76917
Alignment:
| Q |
69 |
aaaaactcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
76851 |
aaaaacccaagtcccacatcggatagataagactcttgagaagagtttataaagaggaggcaatcct |
76917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1138 (Bit Score: 34; Significance: 0.0000000005; HSPs: 2)
Name: scaffold1138
Description:
Target: scaffold1138; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 48 - 108
Target Start/End: Complemental strand, 2000 - 1939
Alignment:
| Q |
48 |
gcgtgaggggagtgtattgggaaaaa-ctcaagtcccacatcagatagataagactcttgat |
108 |
Q |
| |
|
|||||||||| |||||||| |||||| | |||||| |||||| ||||||||||||||||||| |
|
|
| T |
2000 |
gcgtgaggggggtgtattgagaaaaaacccaagtctcacatcggatagataagactcttgat |
1939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1138; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 69 - 134
Target Start/End: Complemental strand, 2184 - 2118
Alignment:
| Q |
69 |
aaaaactcaagtcccacatcagatagataagactcttgatc-gagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||||||||| || || ||||||||| ||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
2184 |
aaaaactcaagtctcaaattggatagataaaactcttgataagagtttatatagaggaggcaatcct |
2118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0054 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: scaffold0054
Description:
Target: scaffold0054; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 60 - 134
Target Start/End: Complemental strand, 21378 - 21302
Alignment:
| Q |
60 |
tgtattgggaaaa-actcaagtcccacatcagatagataagactcttga-tcgagtttagatagaggaggcaatcct |
134 |
Q |
| |
|
||||||||||||| || ||||||||||||| |||||| ||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
21378 |
tgtattgggaaaatacccaagtcccacatcggatagacaagactcttgagaagagtttataaagaggaggcaatcct |
21302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0054; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 21288 - 21252
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
21288 |
ggttttgtaaggatgagttaggcctcaaatttcaaca |
21252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 32; Significance: 0.000000008; HSPs: 2)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 60 - 107
Target Start/End: Complemental strand, 13746 - 13699
Alignment:
| Q |
60 |
tgtattgggaaaaactcaagtcccacatcagatagataagactcttga |
107 |
Q |
| |
|
||||||||| |||||||||||| |||||| ||||||| |||||||||| |
|
|
| T |
13746 |
tgtattggggaaaactcaagtcacacatcggatagatgagactcttga |
13699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 20619 - 20655
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
20619 |
ggttttgtaaggatgagttaggccccaaattacaaca |
20655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0459 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0459
Description:
Target: scaffold0459; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 13377 - 13413
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
13377 |
ggttttgtaaggatgagttaggtcccaaatttcaaca |
13413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366 (Bit Score: 29; Significance: 0.0000005; HSPs: 2)
Name: scaffold0366
Description:
Target: scaffold0366; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 11018 - 11054
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
11018 |
ggttttgtaaggatgagttaggtcccaaatttcaaca |
11054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 14684 - 14720
Alignment:
| Q |
1 |
ggttttgtaaggatgatttaggccccaaatttcaaca |
37 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
14684 |
ggttttgtaaggatgagttaggtcccaaatttcaaca |
14720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University