View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_70 (Length: 366)
Name: NF10140A_low_70
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_70 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 15 - 353
Target Start/End: Complemental strand, 52891250 - 52890911
Alignment:
| Q |
15 |
cacaattggtggctagtagaagaagggtttggctgaaagtgtatggaatttccatgcacatgtgggaggaaggcttcttcaagcagatatgatcnnnnnn |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52891250 |
cacaattggtggctagtagaagaagggtttggctgaaagtgtatggaatttctatgcacatgtgggaggaaggcttcttcaagcagatatgatctttttt |
52891151 |
T |
|
| Q |
115 |
nggggagtttatggactttgacgaggatacggttacgttgcacagctgtatgtcaaggattctggttcgcacggcaaggctggggattatcaatgaattt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52891150 |
tggggagtttatggactttgacgaggatacggttacgttgcacagctgtatgtcaaggattctggttcgcacggcaaggctggggattatcaatgaattt |
52891051 |
T |
|
| Q |
215 |
ctcaaaataaatgtgatgggggcggtttttggcctatgggtggtgg-cgaaggggtggccctggagattaatttaacggcagcatcggtgggaccaggat |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
52891050 |
ctcaaaataaatgtgatgggggcggtttttggcctatgggtggtggaggaaggggtggccctgaagattaatttaacagcagcatcggtgggaccaggat |
52890951 |
T |
|
| Q |
314 |
gggaagaggcgtcgtcggcatcttctcacggcggagatat |
353 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52890950 |
gggaagaggcgtcgtcggcatcttctcacggcggagatat |
52890911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University