View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_71 (Length: 365)
Name: NF10140A_low_71
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_71 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 17 - 338
Target Start/End: Complemental strand, 41793304 - 41792983
Alignment:
| Q |
17 |
cctgtggctggagatgaggagaggattatcgagatttctgacacgcgccgccgtgatccggatggtagaatgccacagttttcgccggcgcaggaggcgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41793304 |
cctgtggctggagatgaggagaggattatcgagatttctgacacgcgccgccgtgatccggatggtagaatgccacagttttcgccggcgcaggaggcgt |
41793205 |
T |
|
| Q |
117 |
tgcttctcattcatgagaggctgttggagaacgatccggggtttgaggatgaggaggactacggcggcggaagaggtggtggtgggaagcgtgtttctag |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41793204 |
tgcttctcattcatgagaggctgttggagaacgatccggggtttgaggatgaggaggactacggcggcggaagaggtggtggtgggaagcgtgtttctag |
41793105 |
T |
|
| Q |
217 |
taggttggttgtttcgaaaatgcatgttgggtcattgctaggaaaaggtggaaaaataattgaacagatgagaattgagacaaagacacaaattaggatt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41793104 |
taggttggttgtttcgaaaatgcatgttgggtcattgctaggaaaaggtggaaaaataattgaacagatgagaattgagacaaagacacaaattaggatt |
41793005 |
T |
|
| Q |
317 |
cttccaagggattcgtatctac |
338 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
41793004 |
cttccaagggattcgtatctac |
41792983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University