View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_89 (Length: 348)
Name: NF10140A_low_89
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10140A_low_89 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 122; Significance: 2e-62; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 197 - 348
Target Start/End: Complemental strand, 1109169 - 1109022
Alignment:
Q |
197 |
aatatatgctttcttcttcacatccttatacgtatttctctgcacatgatctgtagcatctgcaggaaggggttccatgccattattgatctcaatctgt |
296 |
Q |
|
|
|||||||||||||||||||||||| |||||| |||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1109169 |
aatatatgctttcttcttcacatcgttatacatatttctctg-ac---atctgtagcatctgcaggaaggggttccatgccattattgatctcaatctgt |
1109074 |
T |
 |
Q |
297 |
tcagacacattgtgaactgcaaagatcacattcatatgtctgaaccatcgtt |
348 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1109073 |
tcagacacattgtgaactgcaaagatcacattcatatgtctgaaccatcgtt |
1109022 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University