View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140A_low_94 (Length: 345)
Name: NF10140A_low_94
Description: NF10140A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140A_low_94 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 316; Significance: 1e-178; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 7 - 330
Target Start/End: Original strand, 36170376 - 36170699
Alignment:
| Q |
7 |
gttggtgttgaggaagttaagagatttatggttgaggaggatgcggtgtcgacttttatcaggctagtgaaatcaaaggaggaagcaattcaggtgaatt |
106 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36170376 |
gttggtgttgaggaagttaagagattcatggttgaggaggatgcggtgtcgacttttatcaggctagtgaaatcaaaggaggaagcaattcaggtgaatt |
36170475 |
T |
 |
| Q |
107 |
caatagggttcattcagaatattgcctttggagatgagttggttaggcaaacggtgattagagaaggcggaatccgtgctttgttacgtgttttagatcc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36170476 |
caatagggttcattcagaatattgcctttggagatgagttggttaggcaaatggtgattagagaaggcggaatccgtgctttgttacgtgttttagatcc |
36170575 |
T |
 |
| Q |
207 |
gaaatggtcatattcttcaaaaacaaaggaaataacaatgagggctattgaaagtttgtgttttacttcatctagctctgtaagtattttaatgagttat |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36170576 |
gaaatggtcatattcttcaaaaacaaaggaaataacaatgagggctattgaaagtttgtgttttacttcatctagctctgtaagtattttaatgagttat |
36170675 |
T |
 |
| Q |
307 |
ggttttgtggatcagttgctatat |
330 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
36170676 |
ggttttgtggatcagttgctatat |
36170699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 279 - 330
Target Start/End: Complemental strand, 1286394 - 1286343
Alignment:
| Q |
279 |
tagctctgtaagtattttaatgagttatggttttgtggatcagttgctatat |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1286394 |
tagctctgtaagtattttaatgagttatggttttgtggatcagttgctatat |
1286343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University