View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140_high_6 (Length: 230)
Name: NF10140_high_6
Description: NF10140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10140_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 38936165 - 38936377
Alignment:
Q |
1 |
ggggaggtcggagatatgtgaagcgccgtcgtgtgtggcggcgatagtgaacaaagtattgaaagtatccaccggagcgacggagcacgcggttacaata |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
38936165 |
ggggaggtcggagatatgtgaagcgccgtcgtgtgtggtggcgatagtgaacaaagtattgaaagtatccaccgtagcgacggagcacgcggttacaata |
38936264 |
T |
 |
Q |
101 |
ctatggagtgtgtgttatttatttcgtgatcaaaaggcgcaagaagctgttacgaaagcgaatggattaacgaagattttgcttctgatgcaaagtaatt |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38936265 |
ctatggagtgtgtgttatttatttcgtgatcaaaaggcgcaagaagctgttacgaaagcgaatggattaacgaagattttgcttctgatgcaaagtaatt |
38936364 |
T |
 |
Q |
201 |
gttcgccacaagt |
213 |
Q |
|
|
||||||||||||| |
|
|
T |
38936365 |
gttcgccacaagt |
38936377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 77 - 213
Target Start/End: Original strand, 43741730 - 43741866
Alignment:
Q |
77 |
gcgacggagcacgcggttacaatactatggagtgtgtgttatttatttcgtgatcaaaaggcgcaagaagctgttacgaaagcgaatggattaacgaaga |
176 |
Q |
|
|
|||||||||||||| || || | || |||||||| |||||| | ||||| |||||||| || |||||||| ||||||| || |||||||||||||||| |
|
|
T |
43741730 |
gcgacggagcacgcagtaacgacgctgtggagtgtttgttatctgtttcgcgatcaaaaagcacaagaagcggttacgatggcaaatggattaacgaaga |
43741829 |
T |
 |
Q |
177 |
ttttgcttctgatgcaaagtaattgttcgccacaagt |
213 |
Q |
|
|
| ||| | || || || ||||||||||| |||||||| |
|
|
T |
43741830 |
tattgttgctaatacagagtaattgttctccacaagt |
43741866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University