View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10140_low_15 (Length: 205)
Name: NF10140_low_15
Description: NF10140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10140_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 15 - 187
Target Start/End: Complemental strand, 50459286 - 50459114
Alignment:
| Q |
15 |
cataggggtattaatgtaaaaggtctccaaaccaggaccaaagtactccaatgaagtgagtttaaggcaatctaatgaacaaaggtttacaccctttttg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
50459286 |
cataggggtattaatgtaaaaggtctccaaaccaggaccaaagtactccaatgaagtgagtttaaggcaatctagtgaacaaaggtttacaccctttttg |
50459187 |
T |
|
| Q |
115 |
atgttgttggatacgacatggcagtttttaacttcaagataactcaaggatgaactcactatctttggcattg |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
50459186 |
atgttgttggatacgacatggcagtttttaacttcaagataacacaaggatgaactcactatctttggcattg |
50459114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University