View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10141_low_13 (Length: 211)
Name: NF10141_low_13
Description: NF10141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10141_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 18 - 198
Target Start/End: Complemental strand, 2653676 - 2653496
Alignment:
| Q |
18 |
caaataaatgatgttgttcataaaaagtttcgcggcgttcgacaacgacgatgggggagatttgctgctgagattcgcgatccaaggcttggtaggagaa |
117 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2653676 |
caaataaatgatgttgttcatcaaaagtttcgcggcgttcgacgacgacgatgggggagatttgctgctgagattcgtgatccaaggcttggtaggagaa |
2653577 |
T |
|
| Q |
118 |
ggtggttagggacatatgatactgctgaagaagctgctttggtttatgatagagctgcaattgattgtagaggtgctgatg |
198 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2653576 |
ggtggttagggacatatgataccgctgaagaagctgctttggtttatgatagagctgcaattgattgtagaggtgctgatg |
2653496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 120 - 175
Target Start/End: Complemental strand, 6507711 - 6507656
Alignment:
| Q |
120 |
tggttagggacatatgatactgctgaagaagctgctttggtttatgatagagctgc |
175 |
Q |
| |
|
|||||||| |||| |||||||||| ||||||||||||| | ||||||||||||||| |
|
|
| T |
6507711 |
tggttaggaacatttgatactgctcaagaagctgcttttgcttatgatagagctgc |
6507656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 138 - 175
Target Start/End: Original strand, 25986021 - 25986058
Alignment:
| Q |
138 |
actgctgaagaagctgctttggtttatgatagagctgc |
175 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
25986021 |
actgctgaagaagctgctttggcttatgatagagctgc |
25986058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University