View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10142_high_18 (Length: 294)
Name: NF10142_high_18
Description: NF10142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10142_high_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 26 - 288
Target Start/End: Original strand, 43396205 - 43396470
Alignment:
| Q |
26 |
cagtgagatactgttatttttgaactgccaaa-----gagtaaaatatcttggtatagctgagattataattgaaggagaggggagagatttatatttca |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43396205 |
cagtgagatactgttatttttgaactgccaaattaaagagtaaaatatcttggtatagctgagattataattgaaggagaggggagagatttat--ttca |
43396302 |
T |
 |
| Q |
121 |
atgctttgtttttggttgagaggaggtgaggggagataatagtgaattaaaattaggggtgtggttacgttgcgatctttgatattgcagacaaatgcag |
220 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43396303 |
atgctttgtttttggttgagagtaggctaggggagataatagtgaattaaaattaggggtgtggttgcgttgcgatctttgatattgcagacaaatgcag |
43396402 |
T |
 |
| Q |
221 |
ttgatgcagatgcaatgtagctgcggagaccactaaagtcattatgttgtggtcgtgcatataattgt |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43396403 |
ttgatgcagatgcaatgtagctgcggagaccactaaagtcattatgttgtggtcgtgcatatagttgt |
43396470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University