View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10142_high_45 (Length: 217)
Name: NF10142_high_45
Description: NF10142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10142_high_45 |
 | |
|
| [»] scaffold0140 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0140 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 101 - 200
Target Start/End: Original strand, 18699 - 18799
Alignment:
| Q |
101 |
accatcaggccctgtgaaattgggttacaaaa-ctttcggctcttctttggagttgttcgattatttcaacagttttcttcatgcttggggtcctaatct |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18699 |
accatcaggccctgtgaaattgggttacaaaaactttcggctcttctttggagttgttcgattatttcaacagttttcttcatgcttggggtcctaatct |
18798 |
T |
|
| Q |
200 |
t |
200 |
Q |
| |
|
| |
|
|
| T |
18799 |
t |
18799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University