View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10142_low_30 (Length: 303)
Name: NF10142_low_30
Description: NF10142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10142_low_30 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 15 - 287
Target Start/End: Original strand, 45280352 - 45280624
Alignment:
| Q |
15 |
cacagataagtcgttggttatgtgggaaatctcttccttggctttcttggagatccaaaagcttccaagtttagtcatagctttatccattttccttctc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45280352 |
cacagataagtcgttggttatgtgggaaatctcttccttggctttcttggagatccaaaagcttccaagtttagtcatagctttatccattttccttctc |
45280451 |
T |
|
| Q |
115 |
aatattttttgcagaaagaaatgaatataaaaatggtgttaaaaacactttagaggcttagagtgtcactatcttggatggtaaaggagatatctcagaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45280452 |
aatattttttgcagaaagaaatgaatataaaaatggtgttaaaaacactttagaggcttagagtgtcactatcttggatggtaaaggagatatctcagaa |
45280551 |
T |
|
| Q |
215 |
cgtacgctgcataacaaatcaggacgtacgctgcatggtgaagtctttcaaatataaactccaacaaaaatta |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45280552 |
cgtacgctgcataacaaatcaggacgtacgctgcatggtgaagactttcaaatataaactccaacaaaaatta |
45280624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University