View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10142_low_31 (Length: 298)
Name: NF10142_low_31
Description: NF10142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10142_low_31 |
 |  |
|
[»] scaffold0147 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0147 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 18 - 290
Target Start/End: Original strand, 5038 - 5314
Alignment:
Q |
18 |
aaatagtttacatatgagcacttaattaataagcgcttattctacaagagcttataaaatgggaaaataagcaaagaagaaactaagagatcaacgtatt |
117 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
5038 |
aaatagtttacatatgagcacttaaataataagcgcttatactacaagagcttataaaatgggaaaatgagcaaagaagaaactaagagatcaacgtatt |
5137 |
T |
 |
Q |
118 |
gcatgaaaacataaagctctaaacagttnnnnnnnnnnnnnn--ggaaagctttaaacagtaggaactaaaccaaataaaataaatagtaactgaattgg |
215 |
Q |
|
|
| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
5138 |
gtatgaaaacataaagctctaaacagttattaaaaaaaaaaaaaggaaagctttaaacagtaggaactaaaccaaataaagtaaatagtaactgaattgg |
5237 |
T |
 |
Q |
216 |
tttttcctatacactagaattgtgattagatgatatttcctttatgtaactaaatttgat--agtctttcctttgct |
290 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
T |
5238 |
tttttcctatacactagaattgtgattagatgatatttcctttatgtaactgaatttgatagagtctttcctttgct |
5314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0147; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 161 - 205
Target Start/End: Original strand, 12919 - 12963
Alignment:
Q |
161 |
gaaagctttaaacagtaggaactaaaccaaataaaataaatagta |
205 |
Q |
|
|
|||||||||||||| | ||||| |||||||||||| ||||||||| |
|
|
T |
12919 |
gaaagctttaaacaatgggaacaaaaccaaataaagtaaatagta |
12963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University