View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10142_low_53 (Length: 247)
Name: NF10142_low_53
Description: NF10142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10142_low_53 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 16008842 - 16009071
Alignment:
| Q |
1 |
gagcggtcgatcttcatggaaactctgggttaagctgtcttaacagagcagcgcccttaaagtagaggtatggcctatgatttatgtatggatcaatcat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
16008842 |
gagcggtcgatcttcatggaaactctgggttaagctgacttaacagagcagcgcccttaaagtagaggtatggcctatgatttatgtatgg----atcat |
16008937 |
T |
 |
| Q |
101 |
ggtccctactccacgaagattggtgccttcccagcctggtcatatacgtatcaaccctcatcttttgtttttcaaatcaatcttggaaggacatatctt- |
199 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16008938 |
ggtccctacttcacgaagattggtgccttcccagcatggtc--atacgtatcaaccctcatcttttgtttttcaaatcaatcttggaaggacatatctta |
16009035 |
T |
 |
| Q |
200 |
atgcagtaagttgagaaaccccagccccttcatctc |
235 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
16009036 |
atgcagtaagttgagaagccccagcccctttatctc |
16009071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University