View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10142_low_58 (Length: 242)
Name: NF10142_low_58
Description: NF10142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10142_low_58 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 16 - 242
Target Start/End: Complemental strand, 32230266 - 32230039
Alignment:
| Q |
16 |
caataagtatatatatgtgtaca-taatgtcatttggttttagtaacaaaacgaagttctgtaattatatgtttcactgttctatgaaatgtacatgaac |
114 |
Q |
| |
|
|||||||||||||||||| | | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32230266 |
caataagtatatatatgtacataataatgtcatttggttttagtaacaaaacgaagttctgtaattatatgtttcactgttctatgaaatgtacatgaac |
32230167 |
T |
 |
| Q |
115 |
atcatgtatagttgcagtatacaaaatacacttggtttttcttcttttctaaggcttaatcagtttcaagatatgcaaattataaaatatcatatgacaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32230166 |
atcatgtatagttgcagtatacaaaaaacacttggtttttcttcttttctaaggctcaatcagtttcaagatatgcaaattataaaatatcatatgacaa |
32230067 |
T |
 |
| Q |
215 |
tgtcaattagacaattctgttaatgttt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
32230066 |
tgtcaattagacaattctgttaatgttt |
32230039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University