View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10142_low_61 (Length: 238)
Name: NF10142_low_61
Description: NF10142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10142_low_61 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 23 - 223
Target Start/End: Complemental strand, 46472305 - 46472105
Alignment:
| Q |
23 |
acaaattataatatgctagttatcttcatgattgttaaatgaatcaaataaatacacctatttgtcagttcaataagaacatagagagaaaacaagcttt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46472305 |
acaaattataatatgctagttatcttcatgattgttaaatcaatcaaataaatacacctatttgtcagttcaataagaacatagagagaaaacaagcttt |
46472206 |
T |
 |
| Q |
123 |
gcacttttggtaataatnnnnnnnngaatacaatgttgtgctttnnnnnnnnccgcagcaagtattaaacaacaccaaaagccaaaactcatagcaaaag |
222 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46472205 |
gcacttttggtaataataaaaaaaagaatacaatgttgtgctttaaacaaaaccgcagcaagtattaaacaacaccaaaagccaaaactcatagcaaaag |
46472106 |
T |
 |
| Q |
223 |
c |
223 |
Q |
| |
|
| |
|
|
| T |
46472105 |
c |
46472105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University