View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10142_low_65 (Length: 232)
Name: NF10142_low_65
Description: NF10142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10142_low_65 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 105 - 216
Target Start/End: Complemental strand, 3559000 - 3558889
Alignment:
| Q |
105 |
caggtagagtataaaataatgttactatgattttgacccnnnnnnnntgactccatttattcatttaattacctctaaaaatttcaattcaacctcaata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3559000 |
caggtagagtataaaataatgttactatgattttgacccaaaaaaaatgactccatttattcatttaattacctctaaaaatttcaattcaacctcaata |
3558901 |
T |
|
| Q |
205 |
ggctattaaaag |
216 |
Q |
| |
|
|||||||||||| |
|
|
| T |
3558900 |
ggctattaaaag |
3558889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 1 - 82
Target Start/End: Complemental strand, 3559105 - 3559024
Alignment:
| Q |
1 |
catttgtgtttgaactaacaatgatggaatctttgggaattgaaagtagtaggtggatcacttatctgtaccctctcccttc |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3559105 |
catttgtgtttgaactaacaatgatggaatctttgggaattgaaagtagtaggtggatcacttatctgtaccctctcccttc |
3559024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University