View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10142_low_71 (Length: 225)
Name: NF10142_low_71
Description: NF10142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10142_low_71 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 11296014 - 11295802
Alignment:
| Q |
1 |
cgataacggcagagagaataacttgtgagatttcgatggtatgaaattaaggttggatttgtcaattaataggttttggataaataagtcaaagact--- |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11296014 |
cgataacggcagagagaataacttgtgagatttcgatggtatgaaattaaggttggatttgtcaattaataggttttggataaataagtcaaagacttgg |
11295915 |
T |
|
| Q |
98 |
-----------tggtccagttttccttcnnnnnnnngtcttggtccaatttttgttttgactgaagtaaacttaacttatttcatttatcaaagacttgg |
186 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11295914 |
ttgccaagtcttggtccaattttccttaaaaaaaaagtcttggtccaatttttgttttgactaaagtaaacttaacttatttcatttatcaaagacttgg |
11295815 |
T |
|
| Q |
187 |
tcgccatgtcttt |
199 |
Q |
| |
|
||| ||||||||| |
|
|
| T |
11295814 |
tcgtcatgtcttt |
11295802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University