View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10142_low_74 (Length: 217)

Name: NF10142_low_74
Description: NF10142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10142_low_74
NF10142_low_74
[»] scaffold0140 (1 HSPs)
scaffold0140 (101-200)||(18699-18799)


Alignment Details
Target: scaffold0140 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: scaffold0140
Description:

Target: scaffold0140; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 101 - 200
Target Start/End: Original strand, 18699 - 18799
Alignment:
101 accatcaggccctgtgaaattgggttacaaaa-ctttcggctcttctttggagttgttcgattatttcaacagttttcttcatgcttggggtcctaatct 199  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18699 accatcaggccctgtgaaattgggttacaaaaactttcggctcttctttggagttgttcgattatttcaacagttttcttcatgcttggggtcctaatct 18798  T
200 t 200  Q
    |    
18799 t 18799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University