View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10144_low_3 (Length: 383)
Name: NF10144_low_3
Description: NF10144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10144_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 331; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 13 - 367
Target Start/End: Original strand, 41936934 - 41937288
Alignment:
| Q |
13 |
taggcccatgattctcttgaaagcttgagatgtctactactgtgatccaaggtttgttggcattgttaactcgaaaattaaaatctaattgtattttatt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41936934 |
taggcccatgattctcttgaaagcttgagatgtctactactgtgatgcaaggtttgttggcattgttaactcgaaaattaaaatctaattgtattttatt |
41937033 |
T |
|
| Q |
113 |
tgaacttgtactggttcttaaaaagtttattatcatagttggatgggatgctgcaaggggaattgttgcatgaaataaagcagtagacacttggaatgga |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
41937034 |
tgaacttgtactggttcttaaaaagtttattatcatagttggatgggatgctgcaaggggaattggcgcatgaaataaagcagtagacacttggagtgga |
41937133 |
T |
|
| Q |
213 |
ttccgaaggtagtttgaggattcaaaaggatctgctaaattctatggatgtagattttgagatgctgagagatttttgagtactttgcattgattgcaga |
312 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
41937134 |
ttccgaaggtagtttgaggattccaaaggatctgctaaattctatggatgtagattttgagatgctgagggatttttgagtactttgcattgattgcaga |
41937233 |
T |
|
| Q |
313 |
agtttcgacgtccttaattttgcatgttggtatggaatttgaccatggtggtaat |
367 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41937234 |
agtttcgacgtccttaattttgcatgttggtatggaatttgaccatggtggtaat |
41937288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University