View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10144_low_4 (Length: 310)
Name: NF10144_low_4
Description: NF10144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10144_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 238 - 301
Target Start/End: Complemental strand, 20519608 - 20519545
Alignment:
| Q |
238 |
ctacattacccttgacgaattgtaggtaatttattcttatcaaaaattccttttttcttcatct |
301 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20519608 |
ctacattatccttgacgaattgtaggtaatttattcttataaaaaattccttttttcttcatct |
20519545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 47242361 - 47242325
Alignment:
| Q |
1 |
tatgaaaccaccacacttgagacgtgtcccctgtcat |
37 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
47242361 |
tatgaaaccaccacacttgagacgtgtgacctgtcat |
47242325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 47256489 - 47256453
Alignment:
| Q |
1 |
tatgaaaccaccacacttgagacgtgtcccctgtcat |
37 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
47256489 |
tatgaaaccaccacacttgagacgtgtaacctgtcat |
47256453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 47299583 - 47299623
Alignment:
| Q |
1 |
tatgaaaccaccacacttgagacgtgtcccctgtcatattt |
41 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
47299583 |
tatgaacccaccacacttgagacgtgtgacctgtcatattt |
47299623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 32731032 - 32730996
Alignment:
| Q |
1 |
tatgaaaccaccacacttgagacgtgtcccctgtcat |
37 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32731032 |
tatgaaaccaccacacttgagacgtgtgacctgtcat |
32730996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University