View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10144_low_6 (Length: 250)
Name: NF10144_low_6
Description: NF10144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10144_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 1 - 156
Target Start/End: Complemental strand, 29630943 - 29630788
Alignment:
| Q |
1 |
tttatttacaactaatataaattaatgaaaaatgagnnnnnnnaaataaaaaaggtgtagcctcaataaagtttaactaaactnnnnnnnccaaatttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
29630943 |
tttatttacaactaatataaattaatgaaaaatgagtttttttaaataaaaaaggtgtagcctcaataaagtttaactaaactaaaaaaaccaaatttgt |
29630844 |
T |
 |
| Q |
101 |
taagttgaatatctttatttgaggtataacacgagatctaacaattgtgtgttttt |
156 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
29630843 |
taagttgaatatctttatttgaggtttaacccgagatctaacaattgtgtgttttt |
29630788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 140 - 177
Target Start/End: Complemental strand, 29630771 - 29630734
Alignment:
| Q |
140 |
aacaattgtgtgtttttatcatttaaaaaggaaaaagt |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29630771 |
aacaattgtgtgtttttatcatttaaaaaggaaaaagt |
29630734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University