View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10144_low_8 (Length: 237)
Name: NF10144_low_8
Description: NF10144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10144_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 112; Significance: 9e-57; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 111 - 222
Target Start/End: Original strand, 29631045 - 29631156
Alignment:
Q |
111 |
actcactcacatgatttctagggaattgaatcacctcttgcggagggcctgaatccaatcgtgattttgtgagtgtaaggagaggaaaatcaaaaattaa |
210 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29631045 |
actcactcacatgatttctagggaattgaatcacctcttgcggagggcctgaatccaatcgtgattttgtgagtgtaaggagaggaaaatcaaaaattaa |
29631144 |
T |
 |
Q |
211 |
aaatgaagaggt |
222 |
Q |
|
|
|||||||||||| |
|
|
T |
29631145 |
aaatgaagaggt |
29631156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 29630934 - 29630977
Alignment:
Q |
1 |
tgtaaataaaggataagatttataaatttcatttcgttttaata |
44 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29630934 |
tgtaaataaaggataagatttataaatttcatttcgttttaata |
29630977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 3 - 35
Target Start/End: Original strand, 29630521 - 29630553
Alignment:
Q |
3 |
taaataaaggataagatttataaatttcatttc |
35 |
Q |
|
|
|||||||| |||||||||||||||||||||||| |
|
|
T |
29630521 |
taaataaaagataagatttataaatttcatttc |
29630553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University