View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_high_16 (Length: 295)
Name: NF10145A_high_16
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 83; Significance: 2e-39; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 11 - 137
Target Start/End: Complemental strand, 29442593 - 29442464
Alignment:
| Q |
11 |
cagagagaggattccggtaagtatctccggcggaagatccgccattggaaggaaggaaggaaggttctagttagggt-------ttagggtttttccttt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
29442593 |
cagagagaggattccggtaagtatctccggcggaagatccaccattggaaggaagg----aaggttctagttagggtttaggccttagggtttttccttt |
29442498 |
T |
 |
| Q |
104 |
cttcctctccatgtacgacccaaatgcaacacag |
137 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
29442497 |
cttcctctccttgtacgacccaaatgcaacacag |
29442464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 209 - 289
Target Start/End: Complemental strand, 29442391 - 29442311
Alignment:
| Q |
209 |
cttgattacgtgatcttggacgcacgaattatgaattactctgagttaatatccttcatttatgattctctctgttttatt |
289 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29442391 |
cttgattacatgatcttggacgcacgaattatgaattactctgagttaatatccttcatttatgattctctctgttttatt |
29442311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 11 - 109
Target Start/End: Original strand, 29424129 - 29424226
Alignment:
| Q |
11 |
cagagagaggattccggtaagtatctccggcggaagatccgccattggaaggaaggaaggaaggttctagttagggtttagggtttttcctttcttcct |
109 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |||||| || ||||| ||||||||| |||||||||| ||||||| ||||||||| |
|
|
| T |
29424129 |
cagagagaggattccggtgagtatctccggcggaagatccgtcattgg-agcttggaagttaggttctagctagggtttagagtttttcatttcttcct |
29424226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 11 - 59
Target Start/End: Complemental strand, 29452585 - 29452537
Alignment:
| Q |
11 |
cagagagaggattccggtaagtatctccggcggaagatccgccattgga |
59 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
29452585 |
cagagagaggataccggtaagtatctccggcggaagatccgccattgga |
29452537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 57 - 94
Target Start/End: Complemental strand, 29452503 - 29452466
Alignment:
| Q |
57 |
ggaaggaaggaaggaaggttctagttagggtttagggt |
94 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
29452503 |
ggaaggaaggaaggaaggttgtagctagggtttagggt |
29452466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000004; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 49 - 106
Target Start/End: Original strand, 10354101 - 10354157
Alignment:
| Q |
49 |
ccgccattggaaggaaggaaggaaggttctagttagggtttagggtttttcctttctt |
106 |
Q |
| |
|
||||||||| |||||||||| ||||||||| | |||||||||||||||||| |||||| |
|
|
| T |
10354101 |
ccgccattgtaaggaaggaatgaaggttct-gctagggtttagggtttttcatttctt |
10354157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 15 - 73
Target Start/End: Complemental strand, 9283404 - 9283343
Alignment:
| Q |
15 |
gagaggattccggtaagtatctccggcggaagatc---cgccattggaaggaaggaaggaag |
73 |
Q |
| |
|
|||| |||| ||| |||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9283404 |
gagaagatttcggcaagtatgtccggcggaagatcggacgccattggaaggaaggaaggaag |
9283343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 36 - 70
Target Start/End: Original strand, 10336751 - 10336785
Alignment:
| Q |
36 |
tccggcggaagatccgccattggaaggaaggaagg |
70 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
10336751 |
tccggcggaagatccgccattgtaaggaaggaagg |
10336785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University