View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_high_7 (Length: 417)
Name: NF10145A_high_7
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_high_7 |
 |  |
|
| [»] scaffold0002 (3 HSPs) |
 |  |  |
|
| [»] scaffold0263 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0002 (Bit Score: 355; Significance: 0; HSPs: 3)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 355; E-Value: 0
Query Start/End: Original strand, 19 - 393
Target Start/End: Original strand, 401552 - 401926
Alignment:
| Q |
19 |
catcaacattgtctggactgaagaaaggaatcttccaactggcgttgaaaattccggtgccttttccatcgacgtaagtctcatgggcaaagcccaaaat |
118 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
401552 |
catcaacattgtctggaccaaagaaaggaatcttccaactggcgttgaaaattccggtgccttttccatcgacgtaagtctcatgggcaaagcccaaaat |
401651 |
T |
 |
| Q |
119 |
gaaatggaattcagggatgtggcggccgataatatcagctgggaaattatttaaagaatctgggtaggacttgacgccaatgtattctctaaaaatgact |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
401652 |
gaaatggaattcagggatgtggcggccgataatatcagctgggaaattatttaaagaatctgggtaggacttcacgccaatgtattctctaaaaatgact |
401751 |
T |
 |
| Q |
219 |
ggattcacatcattgtcaccgatgataggagctgttgacattttggaggatcgatatatgagaaattaatatatactttgttttttgtgttttctatatg |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
401752 |
ggattcacatcattgtcaccgatgataggagctgttgacattttggaggatcgatatatgagaaattaatatatactttgttttttgtgttttctttatg |
401851 |
T |
 |
| Q |
319 |
ttggggtttagatagattggaatgagtaactctaatttatgcatgcccttttataaggctacttctccttcttaa |
393 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
401852 |
ttggggtttagatagattggaatgagtaactctaatttatgcattcccttttataaggctacttctccttcttaa |
401926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 242 - 356
Target Start/End: Original strand, 405323 - 405438
Alignment:
| Q |
242 |
gataggagctgttgacattttggaggatcgatatatgagaaattaatatatactttgtttt-ttgtgttttctatatgttggggtttagatagattggaa |
340 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| |||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
405323 |
gataggagctgttgacatttcggaggatcgatatatgagaaattaatatataatttctttttttgtgttttccatatgttggggtttagatagattggaa |
405422 |
T |
 |
| Q |
341 |
tgagtaactctaattt |
356 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
405423 |
tgagtaactctaattt |
405438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #3
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 158 - 244
Target Start/End: Original strand, 93525 - 93611
Alignment:
| Q |
158 |
tgggaaattatttaaagaatctgggtaggacttgacgccaatgtattctctaaaaatgactggattcacatcattgtcaccgatgat |
244 |
Q |
| |
|
|||||||||||| | |||| ||||||| | ||| |||||||||||||||| |||||||| ||||| ||| |||||||||||||||| |
|
|
| T |
93525 |
tgggaaattattaagagaagctgggtatggcttcacgccaatgtattctcgaaaaatgaatggatcaacagcattgtcaccgatgat |
93611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0263 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 1)
Name: scaffold0263
Description:
Target: scaffold0263; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 158 - 244
Target Start/End: Original strand, 15355 - 15441
Alignment:
| Q |
158 |
tgggaaattatttaaagaatctgggtaggacttgacgccaatgtattctctaaaaatgactggattcacatcattgtcaccgatgat |
244 |
Q |
| |
|
|||||||||||| | |||| ||||||| | ||| |||||||||||||||| |||||||| ||||| ||| |||||||||||||||| |
|
|
| T |
15355 |
tgggaaattattaagagaagctgggtatggcttcacgccaatgtattctcgaaaaatgaatggatcaacagcattgtcaccgatgat |
15441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University