View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_111 (Length: 365)
Name: NF10145A_low_111
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10145A_low_111 |
 |  |
|
[»] scaffold0048 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0048 (Bit Score: 141; Significance: 7e-74; HSPs: 2)
Name: scaffold0048
Description:
Target: scaffold0048; HSP #1
Raw Score: 141; E-Value: 7e-74
Query Start/End: Original strand, 5 - 217
Target Start/End: Original strand, 16131 - 16343
Alignment:
Q |
5 |
agtttggagttactgaggcagctaacaataagatagttttcatgtgccctcctccaatgttggttctccggactgcagtgcctcccttgacaagcaccgg |
104 |
Q |
|
|
||||||| || ||||||||||||||||||| ||| |||||||||||||||||||| ||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
T |
16131 |
agtttggtgtaactgaggcagctaacaataggatcgttttcatgtgccctcctccgatgttggttctccggactgcagtacctccctccacaagcaccgg |
16230 |
T |
 |
Q |
105 |
tgaagatggaccagcttttcaagttgcgcagtatttctgggcaaattagttattggatgtagttgttttatgggagggatgtgctggttgatatcgtcag |
204 |
Q |
|
|
|||||||||||||||||||||||||| | ||||||||||||||||||| | ||||| ||||||||||||||||||||| || |||||||||||| ||| |
|
|
T |
16231 |
tgaagatggaccagcttttcaagttgagttgtatttctgggcaaattagattttggaagtagttgttttatgggagggaagtcctggttgatatcagcag |
16330 |
T |
 |
Q |
205 |
tgtgatgttgtga |
217 |
Q |
|
|
||||||||||||| |
|
|
T |
16331 |
tgtgatgttgtga |
16343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0048; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 288 - 364
Target Start/End: Original strand, 16413 - 16489
Alignment:
Q |
288 |
caacttaatgttttattaagtataagacttgatgtaatgttattgtgccattgaatgaaaagttaagtgttgtcttg |
364 |
Q |
|
|
|||||||||||||| ||||||| |||||||||||||||||| |||||| |||||||| |||||||||||| ||||| |
|
|
T |
16413 |
caacttaatgtttttttaagtagaagacttgatgtaatgttgttgtgctattgaatgtgaagttaagtgttatcttg |
16489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University