View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_112 (Length: 364)
Name: NF10145A_low_112
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_112 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 11 - 364
Target Start/End: Original strand, 47116765 - 47117118
Alignment:
| Q |
11 |
agatggacatcactccaagcttcctcatacccttgttatttcatttccttatgatatctcnnnnnnnctgacattgttttgtttcatcgcttctcaggta |
110 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
47116765 |
agatggacaccactccaagcttcctcatacccttgttatttcatttccttatgatatctctttttttctgacattgttttgtttcatcgcttctcaggta |
47116864 |
T |
 |
| Q |
111 |
attacaatgagctggacatcatcaa-----ttcaataaccaatttcttttatatctttagtttcaattcaaggagataaatattcataccttttaacgat |
205 |
Q |
| |
|
|||||||| || | | | ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47116865 |
attacaat-agttatattttatcaaagatattcaataaccaatttcttttatatctttagtttcaattcaaggagataaatattcataccttttaacgat |
47116963 |
T |
 |
| Q |
206 |
caaatcacaaagcaaggtaagcaatatcaacgtatcaatgactcgatcgatcaccttttaacgattatttttaatttcttgttttgtagatggataggcg |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47116964 |
caaatcacaaagcaaggtaagcaatatcaacgtatcaatgac----tcgatcaccttttaacgattatttttaatttcttgttttgtagatggataggcg |
47117059 |
T |
 |
| Q |
306 |
gagaatgtatgataggcaacaaagctcaacgggaacgccaacatcaccatcttcgccgg |
364 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
47117060 |
gagaatgtatgataggcaacaaagctcaacgggaacgccaacatcaccgtcttcaccgg |
47117118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University