View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_116 (Length: 363)
Name: NF10145A_low_116
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_116 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 13 - 363
Target Start/End: Original strand, 49132979 - 49133322
Alignment:
| Q |
13 |
tggacatcatcaccatcaccgccgccgtcattgtaacaaacatgaacaccacttggatgacgagagaaatcactcactccacctctcaccaaaagccaat |
112 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49132979 |
tggacatcaccaccatcaccgccgccgtcattgtaacaaacatgaacaccacttggatgacgagagaaatcactcactccacctctcaccaaaagccaat |
49133078 |
T |
 |
| Q |
113 |
ggaaagcatgaggaggaattagctaagattggaacttnnnnnnnnnnnnnnnnnnngatggtggtcatcatgaaggaagaggcatgcctgagaatgttga |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
49133079 |
ggaaagcatgaggaggaattagctaagattggaacttaaaaaaaaaaaa-------gatggtggtcatcatgaaggaaaaggcatgcctgagaatattga |
49133171 |
T |
 |
| Q |
213 |
tggtcgaattgcttgatttataagaatatgttatcctgtcgaagaaatagaacatgttctgtaacattttatcattgttcttcaccagatttagctgtgt |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49133172 |
tggtcgaattgcttgatttataagaatatgttatcctgtcgaagaaatagaacatgttctgtaacattttatcattgttcttcaccagatttagctgtgt |
49133271 |
T |
 |
| Q |
313 |
gtctatccattactttacttgatccaaagttggtgaacaattttcatcatt |
363 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49133272 |
gtctatccattactttacttgatccaaagttggtgaacaattttcatcatt |
49133322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University