View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_122 (Length: 358)
Name: NF10145A_low_122
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_122 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 41 - 338
Target Start/End: Original strand, 26696749 - 26697046
Alignment:
| Q |
41 |
aaacaaaataagctttctagaaacacccctagtataggaacaaaacaaaatgcaaagggaatcataaaattattccaatgaagttcaaacttaaaccata |
140 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26696749 |
aaacaaaataagctt-ctagaaacacccctagtataggaacaaaacaaaatgcaaagggaatcataaaattattccaatgaagttcaaacttaaaccata |
26696847 |
T |
 |
| Q |
141 |
caatcatgacaatagcatatgaacataaaattgggatcacatacttctggtacgatgaatgcattgctgattttgttcttgttctgataagtttaaactc |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26696848 |
caatcatgacaatagcatatgaacataaaattgggatcacatacttctggtacgatgaatgcattgctgattttgttcttgttctgataagtttaaactc |
26696947 |
T |
 |
| Q |
241 |
tcgtcatcaatttctgtcaagttaaggatttaacatcttggatcgaacaaacggtggcacattcttgaccagacaccaccaa-ccaatcattacaatat |
338 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
26696948 |
tcgtcatcaatttctgtcaagttaagaatttaacatcttggatcgaacaaacggtggcacattcttgaccagacaccaccaacccaatcattacaatat |
26697046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University