View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_125 (Length: 357)
Name: NF10145A_low_125
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10145A_low_125 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 6 - 357
Target Start/End: Original strand, 16160659 - 16161005
Alignment:
Q |
6 |
tttggtgttgccggttctgttgagagtacttccttggcctttggtgctgaacatgaatctgctttcaaggctaatggatctggtgtcaaaagaaatcttt |
105 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
T |
16160659 |
tttggtgttgccggttctgctgagagtacttccttggccgttggtgctgaacatgaatctgctttcaa-----atggatctggtgccaaaagaaatcttt |
16160753 |
T |
 |
Q |
106 |
cttctgcctttgttgaagttgactctgatgatgagactcttgcctagaaatatggaaggattagaaagggttgaacgtagtggttggttgtcgaactgtc |
205 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
16160754 |
cttctgcctttgttgaagttgactctgatgatgagactcttgcccagaaatatggaaggattagaaagggttgaacgcagtggttggttgtcgaactgtc |
16160853 |
T |
 |
Q |
206 |
tgagttatcgtttgtaataatggctgcattagtgcatcaattgaaccattgtgtctatgtttgttgttgtttgcttcattttgtttggagatatggactc |
305 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
16160854 |
tgagttatcgtttgtagtaatggctgcattagtgcatcaattgaaccattgtgtctatgtttgttgttgtttgcttcattttgtttggagatgtggactc |
16160953 |
T |
 |
Q |
306 |
cctcttatgttgttccttttgaatttttatgttgtgtgtctcttttatgtga |
357 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
16160954 |
cctcttatgttgttccttttgaatttttatgttgtgtgtctcttttatgtga |
16161005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University