View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_144 (Length: 344)
Name: NF10145A_low_144
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_144 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 3 - 304
Target Start/End: Complemental strand, 23064247 - 23063946
Alignment:
| Q |
3 |
agaaggtaaattgaaactagttttagtttattaattttgtagaaatgtgttattgtagtttgtaatcttgatagtgaaacctatggatgccaacatgttt |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23064247 |
agaaggtaaattgaaactagttttagtttattaattttgtagaaatgtgttattgtagtttgtaatcttgatagtgaaacctatggatgccaacatgttt |
23064148 |
T |
 |
| Q |
103 |
atcattgagtttcatggtatacactcagcaaagtactataacatatgatttgaatttcatgtttataatttgaattatggttctgaatggtggataactg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
23064147 |
atcattgagtttcatggtatacactcagaaaagtactataacatatgatttgaatttcatgtttataatttgaattatggttttgaatggtggataactg |
23064048 |
T |
 |
| Q |
203 |
gatatgttatagaattattatgtaattgtagtttagaatcttgtctagatagtgtgaaacccatgaatggcaacttgtttatcactgaatttcttgatac |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23064047 |
gatatgttatagaattattatgtaattgtagtttagaatcttgtctagatagtgtgaaacccatgaatggcaacttgtttatcactgaatttcttgatac |
23063948 |
T |
 |
| Q |
303 |
ag |
304 |
Q |
| |
|
|| |
|
|
| T |
23063947 |
ag |
23063946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University