View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_155 (Length: 336)
Name: NF10145A_low_155
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_155 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 1 - 326
Target Start/End: Original strand, 42664748 - 42665074
Alignment:
| Q |
1 |
ggctttgttactgcattattaatatattatagatcaatgcccccacccc-ggataaaatacataatttttgcttcttatgcttgtggcttaaggtaaatg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42664748 |
ggctttgttactgcattattaatatattatagatcaatgcccccacccccggataaaatacataatttttgcttcttatgcttgtggcttaaggtaaatg |
42664847 |
T |
 |
| Q |
100 |
tgggtactaccaagcaactccatacaatctgttatcttcaagcggagaactcgtctcgaaagactactccattaggctggagcattccttggcttatatg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
42664848 |
tgggtactaccaagcaactccatacaatctgttatcttcaagcggagaactcgtctcgaaagactactccattaggctggagcattccttggcttataag |
42664947 |
T |
 |
| Q |
200 |
cttcatttattaaacaagactctttaatatggggttcagcaaggcaccaccgtttgatcgtcgacatcctcgacggtttctcttccaacccttcacctcg |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||| |||||||| ||||| |||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
42664948 |
cttcatttattaaacaagactctttaatatggggttcaacaatgcaccaccatttgagcgtcgacatcctcgacggtttcacttccaacacttcacctcg |
42665047 |
T |
 |
| Q |
300 |
ttggccataaccctttattggcttcat |
326 |
Q |
| |
|
|||||||||||||| |||||||||||| |
|
|
| T |
42665048 |
ttggccataaccctctattggcttcat |
42665074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University