View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_158 (Length: 334)
Name: NF10145A_low_158
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10145A_low_158 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 23 - 334
Target Start/End: Original strand, 7752747 - 7753058
Alignment:
Q |
23 |
ttgtccacctcgactttagcttggacagtctcaccggcccaatccctgatttcttaggtcaactcaagaacctcgatgtcatcgacctctccgggaacag |
122 |
Q |
|
|
|||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
7752747 |
ttgttcacctcgactttagcttggacagtctcacaggcccaatccctgatttcttaggtcaactcaagaacctcgatgtcatcgacctctctgggaacag |
7752846 |
T |
 |
Q |
123 |
gtttaccggccaaatccctgcatcactaggtcgactcactaagcttagaagcgctaaccttggctcaaaccaactctccggcccaatcccagcctcctta |
222 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7752847 |
gtttaccggccaaatccctgcatcactaggtcgactcaccaagcttagaagcgctaaccttggctcaaaccaactctccggcccaatcccagcctcctta |
7752946 |
T |
 |
Q |
223 |
ggcatgatcaagagcctagaacaactctacatatacattaacaacttatctggcccaattccagcttctttagctcaacttcctaaactcaacgaacttt |
322 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7752947 |
ggcatgatcaagagcctagaacaactctacatatacattaacaacttatctggcccaattccagcttctttagctcaacttcctaaactcaacgaacttt |
7753046 |
T |
 |
Q |
323 |
ccctatttcaaa |
334 |
Q |
|
|
|||||||||||| |
|
|
T |
7753047 |
ccctatttcaaa |
7753058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University