View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10145A_low_164 (Length: 330)

Name: NF10145A_low_164
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10145A_low_164
NF10145A_low_164
[»] chr1 (2 HSPs)
chr1 (7-107)||(9303418-9303518)
chr1 (220-306)||(9303619-9303706)


Alignment Details
Target: chr1 (Bit Score: 89; Significance: 7e-43; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 7 - 107
Target Start/End: Original strand, 9303418 - 9303518
Alignment:
Q  7 tttggtgttattgctttgtgtggttggttgactggttttggtgatgttgttcgtgatggtgatttttgatgttatgtggtcttggttttgatttggttac 106  Q
    |||| |||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  9303418 tttgatgttattgctttgtgtggttggttgactggttttggtggtgatgttcgtgatggtgatttttgatgttatgtggtcttggttttgatttggttac 9303517  T
Q  107 g 107  Q
    |    
T  9303518 g 9303518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 220 - 306
Target Start/End: Original strand, 9303619 - 9303706
Alignment:
Q  220 attactggtttatgatggtatcagacaaggtttggaattagg-ttgatgcaaaatttggcagctttccttgtgttttttcttgatgtc 306  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
T  9303619 attactggtttatgatggtatcagacaaggtttggaattagggttgatgcaaaatttggcagctttccttgtgttttttcttgatgtc 9303706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University