View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_203 (Length: 311)
Name: NF10145A_low_203
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_203 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 1 - 307
Target Start/End: Complemental strand, 5739419 - 5739103
Alignment:
| Q |
1 |
tcattatttagcaacgtatacaattgttaggtttgtcatttaacaactctttggttgagtttaaccgaaggtaaacaattgaggtcgcttatgatttagg |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| ||||| |
|
|
| T |
5739419 |
tcattatttaacaacgtatacaattgttaggtttgtcatttaacaactctttggttgagtttaaccgaaggcaagcaattgaggtcgcttatgagttagg |
5739320 |
T |
|
| Q |
101 |
acagacaatccattaaaaactaactc----------aattgtttattgatgtaccaccttatatctctcactatttatctaatggaatgatttgaatttc |
190 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5739319 |
acagacaacccattaaaaactaactctcaatctctcaattgtttattgatgtaccaccttatatctctcactatttatctaatggaatgatttgagtttc |
5739220 |
T |
|
| Q |
191 |
ttcccctaaaaaagaattgtcatgtaatctatcaaatacttggtcactcaattggtttcaaagtataaaatagagtgatagtacaaagataaccggatag |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5739219 |
ttcccctaaaaaagaattgtcatgtaatctatcaaatacttggtcactcaattggtttcaaagtataaaatagagtgatagtacaaagataaccggatag |
5739120 |
T |
|
| Q |
291 |
atttagaattatttagc |
307 |
Q |
| |
|
||||||||| ||||||| |
|
|
| T |
5739119 |
atttagaataatttagc |
5739103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University