View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_209 (Length: 308)
Name: NF10145A_low_209
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10145A_low_209 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 1 - 289
Target Start/End: Complemental strand, 24486266 - 24485980
Alignment:
Q |
1 |
tttagagaagaaaacgagaactcatggaaggctttccccagagaaattaatccttacttacatatagataggacatataacttaaagcgcaagttatcaa |
100 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
24486266 |
tttagagaagaaaacgagaactcatagaaggctttccccagagaaattaatccttacttacatatagataggacatataacttaaagcgcaagttatcaa |
24486167 |
T |
 |
Q |
101 |
cctttcaaagaagtttgtaccctttggcaatatgatttgtctttaaagatcatccgtgaatgtcaaatcggccaaatacctctactccgaatggtgatgg |
200 |
Q |
|
|
|||| |||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
24486166 |
cctt-caaagaagtt-gcaccctttggcaatatgatttgtctttaaagatcatccgtgaatgtcaaatcggccaaatacctctactccgaatggttatgg |
24486069 |
T |
 |
Q |
201 |
ctattttattatctctatccattcaatttgtatccataattccgtatccattaaataatagatagttgaaatatccatttttaacgtgt |
289 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
24486068 |
ctattttattatctctatccattcaatttgtatccataattccgtatccattaaataatagatagttgaaatatctatttttaacgtgt |
24485980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University