View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_215 (Length: 306)
Name: NF10145A_low_215
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_215 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 33148156 - 33148393
Alignment:
| Q |
1 |
atttgacgccatggacttttttcctggccctttcaagctatttactttatgctgtattatgggtttgctgccagtaacagtagtggctatggcttcttta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
33148156 |
atttgacgccatggacttttttcctggccctttcaagctatttactttatgctgtattatgggtttgctgccagtaacagtagtggccatggcttcttta |
33148255 |
T |
|
| Q |
101 |
tttttctctcacctctactgctagtgattgttaaataacttgaattggaattttctgcatttgacaattgccggtaacaaattcatgcggttgttagttt |
200 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33148256 |
tttttctctctcccctactgctagtgattgttaaataacttgaattggaattttctgcatttgacaattgccggtaacaaattcatgcggttgttagttt |
33148355 |
T |
|
| Q |
201 |
tcctatgccttcccggcttcccctcccttcactttgaa |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33148356 |
tcctatgccttcccggcttcccctcccttcactttgaa |
33148393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University