View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_236 (Length: 294)
Name: NF10145A_low_236
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_236 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 6 - 286
Target Start/End: Complemental strand, 16294641 - 16294361
Alignment:
| Q |
6 |
gtttggtgttgatgttattgagactcaattcaacttcttcaaactttgcaatttcattcatttgagcttttatcatagacatagctattggtttacacaa |
105 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
16294641 |
gtttggtggtgatgttattgagactcaattcaacttcttcaaactttgcaatttcattcatttgagcttttatcatagacatagctattggtgtacacaa |
16294542 |
T |
|
| Q |
106 |
caattttgttactatcactaaaagaggatatctgaaagtagctcaaacagctacctttcaagagacataaaaaccattaatgagtggtttccatgttggt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16294541 |
caattttgttactatcactaaaagaggatatctgaaagtagctcaaacagctacctttcaagagacataaaaaccattaatgagtggtttccatgttggt |
16294442 |
T |
|
| Q |
206 |
ggtaataacgttgtttattttacttttctcataaatatatggttcatgttgctgggctgtcatacacattacaacctcgtc |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16294441 |
ggtaataacgttgtttattttacttttctcataaatataaggttcatgttgctgggctgtcatacacattacaacctcgtc |
16294361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University