View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_245 (Length: 291)
Name: NF10145A_low_245
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_245 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 1 - 286
Target Start/End: Complemental strand, 29613165 - 29612880
Alignment:
| Q |
1 |
gatgtcatgcaaaatgaaagcttcttgaaggaactgaagtttggaccaggtgatggtaaacttcattattatctttacaactaccgagtaaggcatgcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29613165 |
gatgtcatgcaaaatgaaagcttcttgaaggaactgaagtttggaccaggtgatggtaaacttcattattatctttacaactaccgagtaaggcatgcat |
29613066 |
T |
 |
| Q |
101 |
tgaagtcatcagagcttgggcttgtgcttctgtagtccaaattttggagattaatggtatggatgaattcaaaatcattatgattgtgctgatagacttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29613065 |
tgaagtcatcagagcttgggcttgtgcttctgtagtccaaattttggagattaatggtatggatgaattcaaaatcattatgattgtgctcatagacttt |
29612966 |
T |
 |
| Q |
201 |
gtatggttgcatatgatgttgcaatccattgttagaccttgagttttgctttatttttgaacaaacaaattttgatgtccatctca |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
29612965 |
gtatggttgcatatgatgttgcaatccattgctagaccttgagttttgctttatttttgaacaaacaaattttgatttccttctca |
29612880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University