View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_255 (Length: 288)
Name: NF10145A_low_255
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_255 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 7 - 180
Target Start/End: Complemental strand, 26597859 - 26597686
Alignment:
| Q |
7 |
tactccacgccctaacatcatcatctcatactggttttgatgtgtctgtggatgagtagtagttaacaaagctgtcagattccggtgaccggagaaaaac |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26597859 |
tactccacgccctaacatcatcatctcatactggttttgatgtgtctgtggatgagtagtagttaacaaagctgtcagattccggtgaccggagaaaaac |
26597760 |
T |
 |
| Q |
107 |
tcatccgtagccgctgtcggtatagatgggaaatgggttgaccttgttccatttactagctgtcttagatcata |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26597759 |
tcatccgtagccgctgtcggtatagatgggaaatgggttgaccttgttccatttactagctgtcttagatcata |
26597686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 237 - 275
Target Start/End: Complemental strand, 26597617 - 26597579
Alignment:
| Q |
237 |
catccatttttcatgtatatatgagaggctagggtatat |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26597617 |
catccatttttcatgtatatatgagaggctagggtatat |
26597579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University