View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_260 (Length: 287)
Name: NF10145A_low_260
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10145A_low_260 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 30 - 278
Target Start/End: Complemental strand, 41727300 - 41727052
Alignment:
Q |
30 |
cattgcgggagtagaggggaagggatatttgatttcaatatgtcatcaacatcatattcatttgttttcaatgtaacacataatcgtctctgaatgaaag |
129 |
Q |
|
|
||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
41727300 |
cattgtgggagtagaggggaatggatatttgatttcaatatgtcatcaacatcatattcatttgttttcaatgtaacacataatcgtctctgattgaaag |
41727201 |
T |
 |
Q |
130 |
tacttaatcaactggtttactgcataaatagagttgagatgtttcgtgaattcatcaagatggataaagcttcacgtaaaatggctggtgaaatttctga |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41727200 |
tacttaatcaactggtttactgcataaatagagttgagatgtttcgtgaattcatcaagatggataaagcttcacgtaaaatggctggtgaaatttctga |
41727101 |
T |
 |
Q |
230 |
acctggttcacgagccattgagattgtagtacgtcggggtcatattgtt |
278 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41727100 |
acctggttcacgagccattgagattgtagtacgtcggggtcatattgtt |
41727052 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University