View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_270 (Length: 283)
Name: NF10145A_low_270
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_270 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 9 - 275
Target Start/End: Original strand, 47526662 - 47526938
Alignment:
| Q |
9 |
gaaaagaatagcagcatata----acataagtgagaaagaaagagcagaaaatggaaagagtgttatcaattgctgaaataacggagcaatattggttga |
104 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47526662 |
gaaaagaatagcagcatatatataacataggtgagaaagaaagagaagaaaatggaaagagtgttatcaattgctgaaataacggagcaatattggttga |
47526761 |
T |
 |
| Q |
105 |
cctcgaaagcgtgcaagggaggagacacaaagatgaatcggagtgattcagaatgggctttccaaaagtttttacgtgaacaagaagctgctgaagaagc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47526762 |
cctcgaaagcgtgcaagggaggagacacaaagatgaatcggagtgattcagaatgggctttccaaaagtttttacgtgaacaagaagctgctgaagaagc |
47526861 |
T |
 |
| Q |
205 |
agaagctgctactgcaaagccttcttcatca------tcaacttcaacttcttcttccaccgttgatgtccatctca |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
47526862 |
agaagctgctactgcaaagccttcttcatcatcaacttcaacttcaacttcttcttccaccgttgatgtcaatctca |
47526938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University