View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_277 (Length: 280)
Name: NF10145A_low_277
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10145A_low_277 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 9 - 265
Target Start/End: Complemental strand, 33443836 - 33443579
Alignment:
Q |
9 |
gataatactatggactgcttcggtaaa-ccactgaaacttttaacatgaaaagaatcagattctccatgatccactgacttttgagttatctcagatttg |
107 |
Q |
|
|
|||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33443836 |
gataattctatggactgcttcggtaaaaccactgaaacttttaacatgaaaagaatcagattctccatgatccactgacttttgagttatctcagatttg |
33443737 |
T |
 |
Q |
108 |
caaggagcatttgagcgatttatacacccgaatgcgatttttatgtcatcaaatagttcatcgagacttcgtttcgatatgcgtttttccttcaacatgg |
207 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33443736 |
caaggagcatttgagcgatttatacacccgaatgcgatttttatgtcatcaaatagttcatcgagacttcgtttcgatatgcgtttttccttcaacatgg |
33443637 |
T |
 |
Q |
208 |
cattcaaaacaatctgaagccaatcaaattggttttgatttgttgtatgtttgaattg |
265 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33443636 |
cattcaaaacaatctgaagccaatcaaattggttttgatttgttgtatgtttgaattg |
33443579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University