View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_284 (Length: 278)
Name: NF10145A_low_284
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_284 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 7 - 274
Target Start/End: Complemental strand, 30897979 - 30897711
Alignment:
| Q |
7 |
acaatgaattgcacgaatccagacaaaacaaaccaaatgataaa-tcagaatttagagggtggtggaataataacaaaacgataaaataaaggtctggct |
105 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30897979 |
acaatgaattgcacgaatctagacaaaacaaaccaaatgataaaatcagaatttagagggtggtggaataataacaaaacgataaaataaaggtctggct |
30897880 |
T |
 |
| Q |
106 |
ttcttagggtcttgaattgtggaagacaacccaaccaaacatgacgatatatactaataattagtataattaataccacacggttcaacattttcaacta |
205 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30897879 |
ttcttaacgtcttgaattgtggaagacaacccaaccaaacatgacgatatatactaataattagtataattaataccacacggttcaacattttcaacta |
30897780 |
T |
 |
| Q |
206 |
gctcctctcaacnnnnnnntaaataaacattttcaactagctgttctcaatttaatttattaggagtat |
274 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| ||| ||||||||| ||||||||| |
|
|
| T |
30897779 |
gctcctctcaacaaaaaaataaataaacattttcaactagctgttttcattttaatttagtaggagtat |
30897711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University